Collection of Manually Curated Inferences of Regulons in Prokaryotic Genomes
-- version 3.2 --

Propagation of ModE regulog to Escherichia coli O157:H7 str. EC4045

Reference regulog properties
Source regulog: ModE - Enterobacteriales
Regulator type: Transcription factor
Regulator family: ModE
Regulation mode: repressor (activator)
Biological process: Molybdopterin biosynthesis; Molybdenum homeostasis
Effector: Molybdate
Phylum: Proteobacteria/gamma
Propagated regulon:
Target genome Escherichia coli O157:H7 str. EC4045
Orthologous TF(s) EschericoliO157_010100002975
Regulated genes 3
Built upon 55 sites [see more]
Predicted regulatory interactions in Escherichia coli O157:H7 str. EC4045
Locus tag Position Score Sequence
Position: -199
Score: 6.8
Sequence: CGCTATATACATGATTACATAGCG
Locus tag: EschericoliO157_010100003350
EschericoliO157_010100003350 -199 6.8 CGCTATATACATGATTACATAGCG
Supported by regulated orthologs from reference regulons
Ortholog gene name: moaA
Ortholog function: Molybdenum cofactor biosynthesis protein MoaA
Escherichia coli str. K-12 substr. MG1655 b0781 -199 6.8 CGCTATATACATGATTACATAGCG
Salmonella typhimurium LT2 STM0802 -200 6.6 CGCTATGTATATGTTTATATAGCG
Citrobacter koseri ATCC BAA-895 CKO_02345 -189 6.9 CGCTATATACATGATTATATAGCG
Klebsiella pneumoniae subsp. pneumoniae MGH 78578 KPN_00810 -193 6.8 CGATATATATAAGATTATATAGCG
Enterobacter sp. 638 Ent638_1273 -172 6.1 CGCTATGTATAGAATTATACAGCG
Erwinia amylovora ATCC 49946 EAM_1218 -211 6.5 CGCTATATATCAAAATATATAGCG
Yersinia pestis KIM y3023 -242 6.5 CGTTGTATATAATAATATATAGCG
Serratia proteamaculans 568 Spro_1320 -242 6.6 CGCTGTATACACAATTATATAGCG
Erwinia carotovora subsp. atroseptica SCRI1043 ECA2817 -256 6.5 CGCTATATATTATCTTATATATCG
Edwardsiella tarda EIB202 ETAE_2347 -312 6.9 CGTTATATTTTTGATTATATAACG
Proteus mirabilis HI4320 PMI0610 -241 6.6 CGTTGTATTATAAATTATATAACG
Photorhabdus luminescens subsp. laumondii TTO1 plu1499 -234 6.2 AGGTATATATTCAATTATATAACG
Position: -97
Score: 6.2
Sequence: CGATGTATACAAGCCTATATAGCG
Locus tag: EschericoliO157_010100004045
EschericoliO157_010100004045 -97 6.2 CGATGTATACAAGCCTATATAGCG
Supported by regulated orthologs from reference regulons
Ortholog gene name: dmsA
Ortholog function: Anaerobic dimethyl sulfoxide reductase chain A (EC 1.8.99.-)
Escherichia coli str. K-12 substr. MG1655 b0894 -97 6.2 CGATGTATACAAGCCTATATAGCG
Salmonella typhimurium LT2 STM0964 -95 5.9 CGATATATATCAGACTTTATAGCG
-64 6.3 CGCTATATAAAATTCTATACATCG
Citrobacter koseri ATCC BAA-895 CKO_02177 -100 6.3 CATTATATACAAAACTATATAGCG
-69 6.6 CGTTGTATAAATAACTACATAACG
Klebsiella pneumoniae subsp. pneumoniae MGH 78578 KPN_00926 -61 6.5 CATTATATATATGTCTATATAACG
Enterobacter sp. 638 Ent638_1418 -67 6.4 CTCTATATAAAAAACTATATAGCG
Position: -37
Score: 6.1
Sequence: CGCTATATATTACGATATATAGCG
Locus tag: EschericoliO157_010100012989
EschericoliO157_010100012989 -37 6.1 CGCTATATATTACGATATATAGCG
Supported by regulated orthologs from reference regulons
Ortholog gene name: yghW
Ortholog function: hypothetical protein
Escherichia coli str. K-12 substr. MG1655 b2998 -37 6.2 CGCTATATATGACAATATATAGCG
Salmonella typhimurium LT2 STM3151 -38 6.9 CGCTATATAATTTATTATATAGCG
Citrobacter koseri ATCC BAA-895 CKO_04392 -36 6.5 CGCTATATAATTTGTTATATAGCG
Klebsiella pneumoniae subsp. pneumoniae MGH 78578 KPN_03420 -38 6.9 CGCTATATAATTTATTATATAACG
Enterobacter sp. 638 Ent638_3406 -39 6.4 CGCTGTATAATTTATTATATATCG
Serratia proteamaculans 568 Spro_3145 -45 6.8 CGTTATATAATTATTTATATAGCG
Erwinia carotovora subsp. atroseptica SCRI1043 ECA0060 -44 6.6 CGTTATATTATTTAATATATAACG
Edwardsiella tarda EIB202 ETAE_0941 -50 6.3 CGTTATATATTTAGGTATATAGCG
© 2009-2020 RegPrecise