Propagation of EbgR regulog to Escherichia coli O157:H7 str. EC4045
Source regulog: | EbgR - Enterobacteriales |
Regulator type: | Transcription factor |
Regulator family: | LacI |
Regulation mode: | repressor |
Biological process: | Galactosides utilization |
Effector: | Beta-galactosides |
Phylum: | Proteobacteria/gamma |
Propagated regulon: | |
Target genome | Escherichia coli O157:H7 str. EC4045 |
Orthologous TF(s) | EschericoliO157_010100013424 |
Regulated genes | 1 |

Locus tag | Position | Score | Sequence | |
---|---|---|---|---|
Position: -94
Score: 6.2 Sequence: CTACTTTTTAGTAAAAATTTT
Locus tag: EschericoliO157_010100013429
|
||||
EschericoliO157_010100013429 | -94 | 6.2 | CTACTTTTTAGTAAAAATTTT | |
Supported by regulated orthologs from reference regulons | ||||
Ortholog gene name: ebgA | ||||
Ortholog function: Evolved beta-D-galactosidase, alpha subunit | ||||
Escherichia coli str. K-12 substr. MG1655 | b3076 | -94 | 6.2 | CTACTTTTTAGTAAAAATTTT |
Serratia proteamaculans 568 | Spro_1973 | -59 | 6.2 | GTGAATTTTACTAAATATTTA |