Collection of Manually Curated Inferences of Regulons in Prokaryotic Genomes
-- version 3.2 --

Propagation of NagC regulog to Yersinia pestis FV-1

Reference regulog properties
Source regulog: NagC - Enterobacteriales
Regulator type: Transcription factor
Regulator family: ROK
Regulation mode: repressor (activator)
Biological process: N-acetylglucosamine utilization
Effector: N-acetylglucosamine-6-phosphate
Phylum: Proteobacteria/gamma
Propagated regulon:
Target genome Yersinia pestis FV-1
Orthologous TF(s) No orthologous TFs found
Regulated genes 3
Built upon 68 sites [see more]
Predicted regulatory interactions in Yersinia pestis FV-1
Locus tag Position Score Sequence
Position: -272
Score: 5
Sequence: CTTATTTCGTCAAGAAAAAAATT
Locus tag: YpesF_010100007999
YpesF_010100007999 -272 5 CTTATTTCGTCAAGAAAAAAATT
Supported by regulated orthologs from reference regulons
Ortholog gene name: chbB
Ortholog function: PTS system, chitobiose-specific IIB component (EC 2.7.1.69)
Yersinia pestis KIM y1251 -242 5 CTTATTTCGTCAAGAAAAAAATT
Position: -241
Score: 4.8
Sequence: CTTGTTTTCTGTCGTAAAATAAG
Locus tag: YpesF_010100009509
YpesF_010100009509 -241 4.8 CTTGTTTTCTGTCGTAAAATAAG
Supported by regulated orthologs from reference regulons
Ortholog gene name: glmU
Ortholog function: N-acetylglucosamine-1-phosphate uridyltransferase (EC 2.7.7.23) / Glucosamine-1-phosphate N-acetyltransferase (EC 2.3.1.157)
Escherichia coli str. K-12 substr. MG1655 b3730 -233 4.8 GTTTATTCATTGATCGAAATAAG
Salmonella typhimurium LT2 STM3862 -233 4.8 CTTTATTTATGGAGTAAAAAAAC
Citrobacter koseri ATCC BAA-895 CKO_00067 -233 4.8 CTTTATTCATGGGTCAAAAAAAT
Klebsiella pneumoniae subsp. pneumoniae MGH 78578 KPN_04135 -248 4.7 CTTTATTCAGGTGGCGAAAAAAC
Enterobacter sp. 638 Ent638_4135 -233 5.2 CTTTATTCATGAGGCGAAAAAAT
Yersinia pestis KIM y4133 -235 4.8 CTTGTTTTCTGTCGTAAAATAAG
Serratia proteamaculans 568 Spro_0010 -242 5 CTTTTTTTTTGTTTTAAAATAAG
Proteus mirabilis HI4320 PMI3066 -84 5.3 AATATTTTGTGTAACGAAATATG
Photorhabdus luminescens subsp. laumondii TTO1 plu0038 -85 4.7 GCTTTTTTGTATTGCGAAATATG
Position: -206
Score: 5.1
Sequence: ATTTTTTCACTGACTAAAATAAA
Locus tag: YpesF_010100024757
YpesF_010100024757 -206 5.1 ATTTTTTCACTGACTAAAATAAA
Supported by regulated orthologs from reference regulons
Ortholog gene name: manX
Ortholog function: PTS system, mannose-specific IIAB component
Yersinia pestis KIM y2551 -206 5.1 ATTTTTTCACTGACTAAAATAAA
© 2009-2020 RegPrecise