Collection of Manually Curated Inferences of Regulons in Prokaryotic Genomes
-- version 3.2 --

Propagation of ZntR regulog to Cronobacter turicensis z3032

Reference regulog properties
Source regulog: ZntR - Enterobacteriales
Regulator type: Transcription factor
Regulator family: MerR
Regulation mode: activator
Biological process: Zinc resistance
Effector: Zinc ion, (Zn2+)
Phylum: Proteobacteria/Gamma
Propagated regulon:
Target genome Cronobacter turicensis z3032
Orthologous TF(s) Ctu_38200
Regulated genes 1
Built upon 11 sites [see more]
Predicted regulatory interactions in Cronobacter turicensis z3032
Locus tag Position Score Sequence
Position: -35
Score: 7.7
Sequence: ACTCTGGAGTCGACTCCAGAGT
Locus tag: Ctu_39780
Ctu_39780 -35 7.7 ACTCTGGAGTCGACTCCAGAGT
Supported by regulated orthologs from reference regulons
Ortholog gene name: zntA
Ortholog function: Lead, cadmium, zinc and mercury transporting ATPase (EC 3.6.3.3) (EC 3.6.3.5); Copper-translocating P-type ATPase (EC 3.6.3.4)
Escherichia coli str. K-12 substr. MG1655 b3469 -64 7.7 ACTCTGGAGTCGACTCCAGAGT
Salmonella typhimurium LT2 STM3576 -67 7.7 ACTCTGGAGTCGACTCCAGAGT
Citrobacter koseri ATCC BAA-895 CKO_04898 -67 7.7 ACTCTGGAGTCGACTCCAGAGT
Klebsiella pneumoniae subsp. pneumoniae MGH 78578 KPN_03835 -67 7.7 ACTCTGGAGTCGACTCCAGAGT
Enterobacter sp. 638 Ent638_3873 -66 7.7 ACTCTGGAGTCGACTCCAGAGT
Erwinia amylovora ATCC 49946 EAM_3299 -76 6.9 ACTCTGGAGCTAACTCCAGAGT
Yersinia pestis KIM y0410 -135 7.1 ACTCTGGAGTTGGCTCCAAGGT
Serratia proteamaculans 568 Spro_0209 -69 7.4 ACTCTGGAGTTGACTCCAGGGT
Edwardsiella tarda EIB202 ETAE_0137 -71 7.3 ACTCTGGAGTCGACTCCAACGT
Proteus mirabilis HI4320 PMI3600 -74 6.5 ACTCTGGACTCTACTCCAAGCT
Photorhabdus luminescens subsp. laumondii TTO1 plu4108 -70 7.1 ACTCTGGAGTAGGCTCCAAAGT