Propagation of HutC regulog to Burkholderia pseudomallei NCTC 13177

Reference regulog properties
Source regulog:	HutC - Ralstonia
Regulator type:	Transcription factor
Regulator family:	GntR/Others
Regulation mode:
Biological process:	Histidine utilization
Effector:	cis-Urocanic acid
Phylum:	Proteobacteria
Propagated regulon:
Target genome	Burkholderia pseudomallei NCTC 13177
Orthologous TF(s)	No orthologous TFs found
Regulated genes	1

Built upon 22 sites [see more]

Predicted regulatory interactions in *Burkholderia pseudomallei NCTC 13177*
	Locus tag	Position	Score	Sequence
Position: -70 Score: 5.5 Sequence: CAAGTTGTCTATACAACATC Position: -25 Score: 5.9 Sequence: AAACTTGTATAGACAGGACC Locus tag: BpseN_010100014711
	BpseN_010100014711	-70	5.5	CAAGTTGTCTATACAACATC
		-25	5.9	AAACTTGTATAGACAGGACC
Supported by regulated orthologs from reference regulons
Ortholog gene name: hutH
Ortholog function: Histidine ammonia-lyase (EC 4.3.1.3)
Ralstonia solanacearum GMI1000	RSc2646	-53	5.9	TTATTTGTATATACAACATA
Ralstonia pickettii 12J	Rpic_2880	-60	6.3	TAAGTTGTATATACAACATA
Ralstonia metallidurans CH34	Rmet_5047	-88	4.9	CAACTTGTCTATACAATACT
Ralstonia metallidurans CH34	Rmet_2855	-59	5.4	TAACCTGTATAGACAGGCCC
Ralstonia eutropha JMP134	Reut_A2716	-40	6.2	TAAGCTGTATAGACAGGAAC
Ralstonia eutropha JMP134	Reut_B5637	-94	5.8	ATGCTTGTATATACAACACT
Ralstonia eutropha H16	H16_A3018	-26	6.2	TAAGCTGTATAGACAGGAAC
Cupriavidus taiwanensis	RALTA_A2492	-26	6.2	TAAGCTGTATAGACAGGAAC

Collection of Manually Curated Inferences of Regulons in Prokaryotic Genomes -- version 3.2 --