Propagation of HutC regulog to Burkholderia dolosa AUO158
| Source regulog: | HutC - Ralstonia |
| Regulator type: | Transcription factor |
| Regulator family: | GntR/Others |
| Regulation mode: | |
| Biological process: | Histidine utilization |
| Effector: | cis-Urocanic acid |
| Phylum: | Proteobacteria |
| Propagated regulon: | |
| Target genome | Burkholderia dolosa AUO158 |
| Orthologous TF(s) | BdolA_01004520 |
| Regulated genes | 1 |
| Locus tag | Position | Score | Sequence | |
|---|---|---|---|---|
|
Position: -26
Score: 5.2 Sequence: GAACTTGTCTAGACAGGACT
Locus tag: BdolA_01001229
|
||||
| BdolA_01001229 | -26 | 5.2 | GAACTTGTCTAGACAGGACT | |
| Supported by regulated orthologs from reference regulons | ||||
| Ortholog gene name: hutH | ||||
| Ortholog function: Histidine ammonia-lyase (EC 4.3.1.3) | ||||
| Ralstonia solanacearum GMI1000 | RSc2646 | -53 | 5.9 | TTATTTGTATATACAACATA |
| Ralstonia pickettii 12J | Rpic_2880 | -60 | 6.3 | TAAGTTGTATATACAACATA |
| Ralstonia metallidurans CH34 | Rmet_5047 | -88 | 4.9 | CAACTTGTCTATACAATACT |
| Ralstonia metallidurans CH34 | Rmet_2855 | -59 | 5.4 | TAACCTGTATAGACAGGCCC |
| Ralstonia eutropha JMP134 | Reut_A2716 | -40 | 6.2 | TAAGCTGTATAGACAGGAAC |
| Ralstonia eutropha JMP134 | Reut_B5637 | -94 | 5.8 | ATGCTTGTATATACAACACT |
| Ralstonia eutropha H16 | H16_A3018 | -26 | 6.2 | TAAGCTGTATAGACAGGAAC |
| Cupriavidus taiwanensis | RALTA_A2492 | -26 | 6.2 | TAAGCTGTATAGACAGGAAC |