Propagation of HutC regulog to Burkholderia glumae BGR1
Source regulog: | HutC - Ralstonia |
Regulator type: | Transcription factor |
Regulator family: | GntR/Others |
Regulation mode: | |
Biological process: | Histidine utilization |
Effector: | cis-Urocanic acid |
Phylum: | Proteobacteria |
Propagated regulon: | |
Target genome | Burkholderia glumae BGR1 |
Orthologous TF(s) | No orthologous TFs found |
Regulated genes | 1 |

Locus tag | Position | Score | Sequence | |
---|---|---|---|---|
Position: -26
Score: 5.4 Sequence: TCACTTGTATAGACAGGACG
Locus tag: bglu_1g25210
|
||||
bglu_1g25210 | -26 | 5.4 | TCACTTGTATAGACAGGACG | |
Supported by regulated orthologs from reference regulons | ||||
Ortholog gene name: hutH | ||||
Ortholog function: Histidine ammonia-lyase (EC 4.3.1.3) | ||||
Ralstonia solanacearum GMI1000 | RSc2646 | -53 | 5.9 | TTATTTGTATATACAACATA |
Ralstonia pickettii 12J | Rpic_2880 | -60 | 6.3 | TAAGTTGTATATACAACATA |
Ralstonia metallidurans CH34 | Rmet_5047 | -88 | 4.9 | CAACTTGTCTATACAATACT |
Ralstonia metallidurans CH34 | Rmet_2855 | -59 | 5.4 | TAACCTGTATAGACAGGCCC |
Ralstonia eutropha JMP134 | Reut_A2716 | -40 | 6.2 | TAAGCTGTATAGACAGGAAC |
Ralstonia eutropha JMP134 | Reut_B5637 | -94 | 5.8 | ATGCTTGTATATACAACACT |
Ralstonia eutropha H16 | H16_A3018 | -26 | 6.2 | TAAGCTGTATAGACAGGAAC |
Cupriavidus taiwanensis | RALTA_A2492 | -26 | 6.2 | TAAGCTGTATAGACAGGAAC |