Collection of Manually Curated Inferences of Regulons in Prokaryotic Genomes
-- version 3.2 --

Propagation of HutC regulog to Ralstonia solanacearum UW551

Reference regulog properties
Source regulog: HutC - Ralstonia
Regulator type: Transcription factor
Regulator family: GntR/Others
Regulation mode:
Biological process: Histidine utilization
Effector: cis-Urocanic acid
Phylum: Proteobacteria
Propagated regulon:
Target genome Ralstonia solanacearum UW551
Orthologous TF(s) RRSL_03201
Regulated genes 1
Built upon 22 sites [see more]
Predicted regulatory interactions in Ralstonia solanacearum UW551
Locus tag Position Score Sequence
Position: 12
Score: 5.1
Sequence: TATGTTGTATATACAAATAA
Locus tag: RRSL_03201
RRSL_03201 12 5.1 TATGTTGTATATACAAATAA
Supported by regulated orthologs from reference regulons
Ortholog gene name: hutC
Ortholog function: Histidine utilization repressor, GntR family
Ralstonia solanacearum GMI1000 RSc2648 -99 5.1 TATGTTGTATATACAAATAA
Ralstonia pickettii 12J Rpic_2882 -114 5.4 TATGTTGTATATACAACTTA
© 2009-2020 RegPrecise