Propagation of HutC regulog to Ralstonia solanacearum IPO1609
Source regulog: | HutC - Ralstonia |
Regulator type: | Transcription factor |
Regulator family: | GntR/Others |
Regulation mode: | |
Biological process: | Histidine utilization |
Effector: | cis-Urocanic acid |
Phylum: | Proteobacteria |
Propagated regulon: | |
Target genome | Ralstonia solanacearum IPO1609 |
Orthologous TF(s) | RSIPO_02405 |
Regulated genes | 2 |

Locus tag | Position | Score | Sequence | |
---|---|---|---|---|
Position: -52
Score: 5.9 Sequence: TTATTTGTATATACAACATA
Locus tag: RSIPO_02403
|
||||
RSIPO_02403 | -52 | 5.9 | TTATTTGTATATACAACATA | |
Supported by regulated orthologs from reference regulons | ||||
Ortholog gene name: hutU | ||||
Ortholog function: Urocanate hydratase (EC 4.2.1.49) | ||||
Ralstonia solanacearum GMI1000 | RSc2647 | -53 | 5.9 | TTATTTGTATATACAACATA |
Ralstonia pickettii 12J | Rpic_2881 | -60 | 6.3 | TAAGTTGTATATACAACATA |
Ralstonia metallidurans CH34 | Rmet_5048 | -88 | 4.9 | CAACTTGTCTATACAATACT |
Ralstonia metallidurans CH34 | Rmet_2854 | -59 | 5.4 | TAACCTGTATAGACAGGCCC |
Ralstonia eutropha JMP134 | Reut_A2715 | -40 | 6.2 | TAAGCTGTATAGACAGGAAC |
Ralstonia eutropha JMP134 | Reut_B5636 | -94 | 5.8 | ATGCTTGTATATACAACACT |
Ralstonia eutropha JMP134 | Reut_A0896 | -94 | 5.8 | ATGCTTGTATATACAACACT |
Ralstonia eutropha H16 | H16_A0695 | -83 | 5.6 | ATGCCTGTATATACAGGACT |
Ralstonia eutropha H16 | H16_A3017 | -26 | 6.2 | TAAGCTGTATAGACAGGAAC |
Cupriavidus taiwanensis | RALTA_A0654 | -83 | 5.8 | GCACTTGTATATACAGGAAT |
Cupriavidus taiwanensis | RALTA_A2491 | -26 | 6.2 | TAAGCTGTATAGACAGGAAC |
Position: -99
Score: 5.1 Sequence: TATGTTGTATATACAAATAA
Locus tag: RSIPO_02405
|
||||
RSIPO_02405 | -99 | 5.1 | TATGTTGTATATACAAATAA | |
Supported by regulated orthologs from reference regulons | ||||
Ortholog gene name: hutC | ||||
Ortholog function: Histidine utilization repressor, GntR family | ||||
Ralstonia solanacearum GMI1000 | RSc2648 | -99 | 5.1 | TATGTTGTATATACAAATAA |
Ralstonia pickettii 12J | Rpic_2882 | -114 | 5.4 | TATGTTGTATATACAACTTA |