Collection of Manually Curated Inferences of Regulons in Prokaryotic Genomes
-- version 3.2 --

Propagation of RutR regulog to Ralstonia eutropha JMP134

Reference regulog properties
Source regulog: RutR - Ralstonia
Regulator type: Transcription factor
Regulator family: TetR
Regulation mode: repressor (activator)
Biological process: Pyrimidine utilization
Effector: Uracil
Phylum: Proteobacteria/beta
Propagated regulon:
Target genome Ralstonia eutropha JMP134
Orthologous TF(s) Reut_B3988
Regulated genes 1
Built upon 4 sites [see more]
Predicted regulatory interactions in Ralstonia eutropha JMP134
Locus tag Position Score Sequence
Position: -45
Score: 7.1
Sequence: ACTTGACCATTTGGTCAGGA
Locus tag: Reut_B3985
Reut_B3985 -45 7.1 ACTTGACCATTTGGTCAGGA
Supported by regulated orthologs from reference regulons
Ortholog gene name: ribA2
Ortholog function: GTP cyclohydrolase II (EC 3.5.4.25 ) homolog
Ralstonia metallidurans CH34 Rmet_4572 -45 6.9 ACCTGACCAACTGGTCAGGT
Ralstonia eutropha JMP134 Reut_B3985 -45 7.1 ACTTGACCATTTGGTCAGGA
Ralstonia eutropha H16 H16_B1597 -43 7.3 ACCTGACCATTTGGTCAGGA
Cupriavidus taiwanensis RALTA_B1434 -43 7.1 ACCTGACCGATTGGTCAGGA
© 2009-2020 RegPrecise