Propagation of HutC regulog to Burkholderia multivorans CGD1

Reference regulog properties
Source regulog:	HutC - Ralstonia
Regulator type:	Transcription factor
Regulator family:	GntR/Others
Regulation mode:
Biological process:	Histidine utilization
Effector:	cis-Urocanic acid
Phylum:	Proteobacteria
Propagated regulon:
Target genome	Burkholderia multivorans CGD1
Orthologous TF(s)	BURMUCGD1_5668
Regulated genes	2

Built upon 22 sites [see more]

Predicted regulatory interactions in *Burkholderia multivorans CGD1*
	Locus tag	Position	Score	Sequence
Position: -71 Score: 5.1 Sequence: CAAGTTGTATATACAACTCG Locus tag: BURMUCGD1_2225
	BURMUCGD1_2225	-71	5.1	CAAGTTGTATATACAACTCG
Supported by regulated orthologs from reference regulons
Ortholog gene name: hisT
Ortholog function: Histidine transport protein (permease)
Ralstonia pickettii 12J	Rpic_0834	-126	5.7	CATGATGTATATACAACAAC
Ralstonia metallidurans CH34	Rmet_5046	-88	4.9	CAACTTGTCTATACAATACT
Ralstonia eutropha JMP134	Reut_B5638	-94	5.8	ATGCTTGTATATACAACACT

Position: -26 Score: 5.2 Sequence: GAACTTGTCTAGACAGGATT Locus tag: BURMUCGD1_1049
	BURMUCGD1_1049	-26	5.2	GAACTTGTCTAGACAGGATT
Supported by regulated orthologs from reference regulons
Ortholog gene name: hutH
Ortholog function: Histidine ammonia-lyase (EC 4.3.1.3)
Ralstonia solanacearum GMI1000	RSc2646	-53	5.9	TTATTTGTATATACAACATA
Ralstonia pickettii 12J	Rpic_2880	-60	6.3	TAAGTTGTATATACAACATA
Ralstonia metallidurans CH34	Rmet_5047	-88	4.9	CAACTTGTCTATACAATACT
Ralstonia metallidurans CH34	Rmet_2855	-59	5.4	TAACCTGTATAGACAGGCCC
Ralstonia eutropha JMP134	Reut_A2716	-40	6.2	TAAGCTGTATAGACAGGAAC
Ralstonia eutropha JMP134	Reut_B5637	-94	5.8	ATGCTTGTATATACAACACT
Ralstonia eutropha H16	H16_A3018	-26	6.2	TAAGCTGTATAGACAGGAAC
Cupriavidus taiwanensis	RALTA_A2492	-26	6.2	TAAGCTGTATAGACAGGAAC

Collection of Manually Curated Inferences of Regulons in Prokaryotic Genomes -- version 3.2 --