Collection of Manually Curated Inferences of Regulons in Prokaryotic Genomes
-- version 3.2 --

Propagation of HutC regulog to Burkholderia pseudomallei 91

Reference regulog properties
Source regulog: HutC - Ralstonia
Regulator type: Transcription factor
Regulator family: GntR/Others
Regulation mode:
Biological process: Histidine utilization
Effector: cis-Urocanic acid
Phylum: Proteobacteria
Propagated regulon:
Target genome Burkholderia pseudomallei 91
Orthologous TF(s) No orthologous TFs found
Regulated genes 1
Built upon 22 sites [see more]
Predicted regulatory interactions in Burkholderia pseudomallei 91
Locus tag Position Score Sequence
Position: -70
Score: 5.5
Sequence: CAAGTTGTCTATACAACATC
Position: -25
Score: 5.9
Sequence: AAACTTGTATAGACAGGACC
Locus tag: Bpse9_010100015927
Bpse9_010100015927 -70 5.5 CAAGTTGTCTATACAACATC
-25 5.9 AAACTTGTATAGACAGGACC
Supported by regulated orthologs from reference regulons
Ortholog gene name: hutH
Ortholog function: Histidine ammonia-lyase (EC 4.3.1.3)
Ralstonia solanacearum GMI1000 RSc2646 -53 5.9 TTATTTGTATATACAACATA
Ralstonia pickettii 12J Rpic_2880 -60 6.3 TAAGTTGTATATACAACATA
Ralstonia metallidurans CH34 Rmet_5047 -88 4.9 CAACTTGTCTATACAATACT
Ralstonia metallidurans CH34 Rmet_2855 -59 5.4 TAACCTGTATAGACAGGCCC
Ralstonia eutropha JMP134 Reut_A2716 -40 6.2 TAAGCTGTATAGACAGGAAC
Ralstonia eutropha JMP134 Reut_B5637 -94 5.8 ATGCTTGTATATACAACACT
Ralstonia eutropha H16 H16_A3018 -26 6.2 TAAGCTGTATAGACAGGAAC
Cupriavidus taiwanensis RALTA_A2492 -26 6.2 TAAGCTGTATAGACAGGAAC