Propagation of SusR2 regulog to Bacteroides stercoris ATCC 43183
| Source regulog: | SusR2 - Bacteroidaceae |
| Regulator type: | Transcription factor |
| Regulator family: | [Other] |
| Regulation mode: | repressor |
| Biological process: | Starch utilization |
| Effector: | |
| Phylum: | Bacteroidetes |
| Propagated regulon: | |
| Target genome | Bacteroides stercoris ATCC 43183 |
| Orthologous TF(s) | BACSTE_01927 |
| Regulated genes | 1 |
| Locus tag | Position | Score | Sequence | |
|---|---|---|---|---|
|
Position: -273
Score: 6.3 Sequence: TAAATCACTACTTTTTCACT
Locus tag: BACSTE_01926
|
||||
| BACSTE_01926 | -273 | 6.3 | TAAATCACTACTTTTTCACT | |
| Supported by regulated orthologs from reference regulons | ||||
| Ortholog gene name: susC2 | ||||
| Ortholog function: SusC2, outer membrane protein involved in starch binding | ||||
| Bacteroides stercoris ATCC 43183 | BACSTE_01926 | -350 | 6.1 | ATTTTTACTACTTTTTTAGT |
| -273 | 6.3 | TAAATCACTACTTTTTCACT | ||