Propagation of SusR2 regulog to Bacteroides thetaiotaomicron VPI-5482
| Source regulog: | SusR2 - Bacteroidaceae |
| Regulator type: | Transcription factor |
| Regulator family: | [Other] |
| Regulation mode: | repressor |
| Biological process: | Starch utilization |
| Effector: | |
| Phylum: | Bacteroidetes |
| Propagated regulon: | |
| Target genome | Bacteroides thetaiotaomicron VPI-5482 |
| Orthologous TF(s) | BT3091 |
| Regulated genes | 1 |
| Locus tag | Position | Score | Sequence | |
|---|---|---|---|---|
|
Position: -186
Score: 6.1 Sequence: AAATCCACTACTTTTTTAGC
Locus tag: BT3090
|
||||
| BT3090 | -186 | 6.1 | AAATCCACTACTTTTTTAGC | |
| Supported by regulated orthologs from reference regulons | ||||
| Ortholog gene name: susC2 | ||||
| Ortholog function: SusC2, outer membrane protein involved in starch binding | ||||
| Bacteroides cellulosilyticus DSM 14838 | BACCELL_04952 | -208 | 5.7 | ATTTTTACTACTTTTTTGGA |
| -131 | 6.2 | AAAACTACTACTTTTTCACT | ||
| Bacteroides ovatus ATCC 8483 | BACOVA_02787 | -204 | 6.6 | AAAATCACTACTTTTTTAGT |
| -127 | 5.9 | TAAATCACTATATTTTTGCT | ||
| Bacteroides thetaiotaomicron VPI-5482 | BT3090 | -186 | 6.1 | AAATCCACTACTTTTTTAGC |
| -109 | 5.9 | TAAACCACTATATTTTTGCT | ||
| Bacteroides uniformis ATCC 8492 | BACUNI_01942 | -206 | 6.2 | ATTTTCACTACTTTTTTAGT |
| -129 | 6.5 | TAAACCACTACTTTTTTACT | ||