Propagation of MntR regulog to Corynebacterium glutamicum ATCC 13032

Reference regulog properties
Source regulog:	MntR - Corynebacteriaceae
Regulator type:	Transcription factor
Regulator family:	DtxR
Regulation mode:	repressor
Biological process:	Manganese homeostasis
Effector:	Manganese ion, (Mn2+)
Phylum:	Actinobacteria
Propagated regulon:
Target genome	Corynebacterium glutamicum ATCC 13032
Orthologous TF(s)	cg0741
Regulated genes	1

Built upon 16 sites [see more]

Predicted regulatory interactions in *Corynebacterium glutamicum ATCC 13032*
	Locus tag	Position	Score	Sequence
Position: -34 Score: 6.3 Sequence: CTGTTCAATGCGTTGAACAT Locus tag: cg1623
	cg1623	-34	6.3	CTGTTCAATGCGTTGAACAT
Supported by regulated orthologs from reference regulons
Ortholog gene name: mntT
Ortholog function: Predicted manganese transporter
Corynebacterium efficiens YS-314	CE1566	-34	6	ATGTTCATGCCATTGAACAT
Corynebacterium glutamicum ATCC 13032	cg1623	-34	6.3	CTGTTCAATGCGTTGAACAT

Collection of Manually Curated Inferences of Regulons in Prokaryotic Genomes -- version 3.2 --