Propagation of MntR regulog to Corynebacterium glutamicum R
| Source regulog: | MntR - Corynebacteriaceae |
| Regulator type: | Transcription factor |
| Regulator family: | DtxR |
| Regulation mode: | repressor |
| Biological process: | Manganese homeostasis |
| Effector: | Manganese ion, (Mn2+) |
| Phylum: | Actinobacteria |
| Propagated regulon: | |
| Target genome | Corynebacterium glutamicum R |
| Orthologous TF(s) | cgR_0157, cgR_0757 |
| Regulated genes | 1 |
| Locus tag | Position | Score | Sequence | |
|---|---|---|---|---|
|
Position: -34
Score: 6.1 Sequence: CTGTTCAATCCGTTGAACAT
Locus tag: cgR_1495
|
||||
| cgR_1495 | -34 | 6.1 | CTGTTCAATCCGTTGAACAT | |
| Supported by regulated orthologs from reference regulons | ||||
| Ortholog gene name: mntT | ||||
| Ortholog function: Predicted manganese transporter | ||||
| Corynebacterium efficiens YS-314 | CE1566 | -34 | 6 | ATGTTCATGCCATTGAACAT |
| Corynebacterium glutamicum ATCC 13032 | cg1623 | -34 | 6.3 | CTGTTCAATGCGTTGAACAT |