Propagation of MntR regulog to Corynebacterium urealyticum DSM 7109
| Source regulog: | MntR - Corynebacteriaceae |
| Regulator type: | Transcription factor |
| Regulator family: | DtxR |
| Regulation mode: | repressor |
| Biological process: | Manganese homeostasis |
| Effector: | Manganese ion, (Mn2+) |
| Phylum: | Actinobacteria |
| Propagated regulon: | |
| Target genome | Corynebacterium urealyticum DSM 7109 |
| Orthologous TF(s) | cur_0586 |
| Regulated genes | 1 |
| Locus tag | Position | Score | Sequence | |
|---|---|---|---|---|
|
Position: -56
Score: 6.6 Sequence: AAGTTCAATACATTGAACTT
Locus tag: cur_0526
|
||||
| cur_0526 | -56 | 6.6 | AAGTTCAATACATTGAACTT | |
| Supported by regulated orthologs from reference regulons | ||||
| Ortholog gene name: mtsB | ||||
| Ortholog function: Manganese ABC transporter, ATP-binding protein | ||||
| Corynebacterium urealyticum DSM 7109 | cur_0526 | -56 | 6.6 | AAGTTCAATACATTGAACTT |