Propagation of Dbac_1936 regulog to Desulfomicrobium baculatum DSM 4028
| Source regulog: | Dbac_1936 - Desulfovibrionales |
| Regulator type: | Transcription factor |
| Regulator family: | ArsR |
| Regulation mode: | |
| Biological process: | |
| Effector: | |
| Phylum: | Proteobacteria/delta |
| Propagated regulon: | |
| Target genome | Desulfomicrobium baculatum DSM 4028 |
| Orthologous TF(s) | Dbac_1936 |
| Regulated genes | 1 |
| Locus tag | Position | Score | Sequence | |
|---|---|---|---|---|
|
Position: -49
Score: 7.1 Sequence: CATATTAATATTTGTTTATATG
Locus tag: Dbac_1936
|
||||
| Dbac_1936 | -49 | 7.1 | CATATTAATATTTGTTTATATG | |
| Supported by regulated orthologs from reference regulons | ||||
| Ortholog gene name: Dbac_1936 | ||||
| Ortholog function: transcriptional regulator, ArsR family | ||||
| Desulfomicrobium baculatum DSM 4028 | Dbac_1936 | -49 | 7.1 | CATATTAATATTTGTTTATATG |