Collection of Manually Curated Inferences of Regulons in Prokaryotic Genomes
-- version 3.2 --

Propagation of ArsR3 regulog to Desulfovibrio vulgaris str. Miyazaki F

Reference regulog properties
Source regulog: ArsR3 - Desulfovibrionales
Regulator type: Transcription factor
Regulator family: ArsR
Regulation mode: repressor
Biological process: Arsenic resistance
Effector:
Phylum: Proteobacteria/delta
Propagated regulon:
Target genome Desulfovibrio vulgaris str. Miyazaki F
Orthologous TF(s) DvMF_2392
Regulated genes 1
Built upon 4 sites [see more]
Predicted regulatory interactions in Desulfovibrio vulgaris str. Miyazaki F
Locus tag Position Score Sequence
Position: -29
Score: 6.6
Sequence: CAGTTCAACATTCGTTGTATTA
Locus tag: DvMF_2392
DvMF_2392 -29 6.6 CAGTTCAACATTCGTTGTATTA
Supported by regulated orthologs from reference regulons
Ortholog gene name: arsR3
Ortholog function: putative transcriptional regulator, ArsR family
Desulfovibrio vulgaris str. Miyazaki F DvMF_2392 -29 6.6 CAGTTCAACATTCGTTGTATTA
Desulfovibrio desulfuricans subsp. desulfuricans str. ATCC 27774 Ddes_1925 -29 6.3 CAATTCAATATAAGTTGAAATA