Propagation of ArsR3 regulog to Desulfovibrio vulgaris str. Miyazaki F

Reference regulog properties
Source regulog:	ArsR3 - Desulfovibrionales
Regulator type:	Transcription factor
Regulator family:	ArsR
Regulation mode:	repressor
Biological process:	Arsenic resistance
Effector:
Phylum:	Proteobacteria/delta
Propagated regulon:
Target genome	Desulfovibrio vulgaris str. Miyazaki F
Orthologous TF(s)	DvMF_2392
Regulated genes	1

Built upon 4 sites [see more]

Predicted regulatory interactions in *Desulfovibrio vulgaris str. Miyazaki F*
	Locus tag	Position	Score	Sequence
Position: -29 Score: 6.6 Sequence: CAGTTCAACATTCGTTGTATTA Locus tag: DvMF_2392
	DvMF_2392	-29	6.6	CAGTTCAACATTCGTTGTATTA
Supported by regulated orthologs from reference regulons
Ortholog gene name: arsR3
Ortholog function: putative transcriptional regulator, ArsR family
Desulfovibrio vulgaris str. Miyazaki F	DvMF_2392	-29	6.6	CAGTTCAACATTCGTTGTATTA
Desulfovibrio desulfuricans subsp. desulfuricans str. ATCC 27774	Ddes_1925	-29	6.3	CAATTCAATATAAGTTGAAATA

Collection of Manually Curated Inferences of Regulons in Prokaryotic Genomes -- version 3.2 --