Propagation of ModE2 regulog to Desulfohalobium retbaense DSM 5692

Reference regulog properties
Source regulog:	ModE2 - Desulfovibrionales
Regulator type:	Transcription factor
Regulator family:	ModE
Regulation mode:	repressor
Biological process:	Molybdopterin biosynthesis; Molybdenum homeostasis
Effector:	Molybdenum
Phylum:	Proteobacteria/delta
Propagated regulon:
Target genome	Desulfohalobium retbaense DSM 5692
Orthologous TF(s)	Dret_2172
Regulated genes	2

Built upon 48 sites [see more]

Predicted regulatory interactions in *Desulfohalobium retbaense DSM 5692*
	Locus tag	Position	Score	Sequence
Position: -32 Score: 4.4 Sequence: TATATGTCTTTTTTAGCAAAGG Locus tag: Dret_0525
	Dret_0525	-32	4.4	TATATGTCTTTTTTAGCAAAGG
Supported by regulated orthologs from reference regulons
Ortholog gene name: wtpA
Ortholog function: ABC-type tungstate/molybdate transport system, periplasmic component
Desulfohalobium retbaense DSM 5692	Dret_0525	-32	4.4	TATATGTCTTTTTTAGCAAAGG
Desulfomicrobium baculatum DSM 4028	Dbac_2354	-76	4.4	TTTCTGTCTTTGTTGACTTAAA
Desulfovibrio salexigens DSM 2638	Desal_2416	-106	5	ATTATGCTCTCCATGACATATG

Position: -166 Score: 4.6 Sequence: GCTATGCAAAAAATCACATAAG Locus tag: Dret_1807
	Dret_1807	-166	4.6	GCTATGCAAAAAATCACATAAG
Supported by regulated orthologs from reference regulons
Ortholog gene name: DVU1560
Ortholog function: molybdopterin binding domain protein
Desulfohalobium retbaense DSM 5692	Dret_1807	-166	4.6	GCTATGCAAAAAATCACATAAG
Desulfomicrobium baculatum DSM 4028	Dbac_1563	-192	5	GTTATGCCTTTCCGGGCATATT
		-63	5.4	GATATGTCAATATTGACATGTT

Collection of Manually Curated Inferences of Regulons in Prokaryotic Genomes -- version 3.2 --