Propagation of TunR regulog to Desulfovibrio desulfuricans subsp. desulfuricans str. ATCC 27774

Reference regulog properties
Source regulog:	TunR - Desulfovibrionales
Regulator type:	Transcription factor
Regulator family:	TunR
Regulation mode:	activator
Biological process:	Tungsten homeostasis; Molybdenum homeostasis
Effector:	Molybdate; Tungsten
Phylum:	Proteobacteria/delta
Propagated regulon:
Target genome	Desulfovibrio desulfuricans subsp. desulfuricans str. ATCC 27774
Orthologous TF(s)	Ddes_0167
Regulated genes	3

Built upon 37 sites [see more]

Predicted regulatory interactions in *Desulfovibrio desulfuricans subsp. desulfuricans str. ATCC 27774*
	Locus tag	Position	Score	Sequence
Position: -100 Score: 5 Sequence: TATTCACGATTATTATAAAAACCGTGAACA Locus tag: Ddes_0089
	Ddes_0089	-100	5	TATTCACGATTATTATAAAAACCGTGAACA
Supported by regulated orthologs from reference regulons
Ortholog gene name: Ddes_0089
Ortholog function: TSUP family transporter
Desulfovibrio desulfuricans subsp. desulfuricans str. ATCC 27774	Ddes_0089	-100	5	TATTCACGATTATTATAAAAACCGTGAACA

Position: -85 Score: 5 Sequence: AGATCACGATTTACATAAAAAGCGTGAACA Locus tag: Ddes_0167
	Ddes_0167	-85	5	AGATCACGATTTACATAAAAAGCGTGAACA
Supported by regulated orthologs from reference regulons
Ortholog gene name: TunR
Ortholog function: XerD family transcriptional regulator
Desulfovibrio desulfuricans subsp. desulfuricans str. ATCC 27774	Ddes_0167	-85	5	AGATCACGATTTACATAAAAAGCGTGAACA

Collection of Manually Curated Inferences of Regulons in Prokaryotic Genomes -- version 3.2 --