Collection of Manually Curated Inferences of Regulons in Prokaryotic Genomes
-- version 3.2 --

Propagation of MurR regulog to Staphylococcus aureus subsp. aureus str. Newman

Reference regulog properties
Source regulog: MurR - Staphylococcaceae
Regulator type: Transcription factor
Regulator family: RpiR
Regulation mode: repressor
Biological process: N-acetylmuramate utilization
Effector: N-acetylmuramate-6-phosphate
Phylum: Firmicutes
Propagated regulon:
Target genome Staphylococcus aureus subsp. aureus str. Newman
Orthologous TF(s) NWMN_2217, NWMN_0137
Regulated genes 1
Built upon 7 sites [see more]
Predicted regulatory interactions in Staphylococcus aureus subsp. aureus str. Newman
Locus tag Position Score Sequence
Position: -115
Score: 5.4
Sequence: ATATGTAAGATTATTACAATG
Locus tag: NWMN_0134
NWMN_0134 -115 5.4 ATATGTAAGATTATTACAATG
Supported by regulated orthologs from reference regulons
Ortholog gene name: SA0184
Ortholog function: Outer surface protein of unknown function, N-acetylmuramate-related
Staphylococcus aureus subsp. aureus N315 SA0184 -133 5.4 ATATGTAAGATTATTACAATG
Staphylococcus capitis SK14 STACA0001_1175 -65 5.3 AATTGTAAACGTTTAATAATA
Staphylococcus epidermidis ATCC 12228 SE1888 -66 5.3 AATTGTAAACTTGTTGCAATA
Staphylococcus carnosus subsp. carnosus TM300 Sca_2140 -114 5.6 TATTGTAATAAAATTTCAATT
Staphylococcus haemolyticus JCSC1435 SH0743 -91 5.6 AATTATAAAAATTATATAATA
Staphylococcus saprophyticus subsp. saprophyticus ATCC 15305 SSP0596 -105 5.3 ATTTGTAATAAAATTTCATTT
-64 5.6 AATTGTAATACTTTTTCATAT