Propagation of MurR regulog to Staphylococcus aureus subsp. aureus str. Newman
| Source regulog: | MurR - Staphylococcaceae |
| Regulator type: | Transcription factor |
| Regulator family: | RpiR |
| Regulation mode: | repressor |
| Biological process: | N-acetylmuramate utilization |
| Effector: | N-acetylmuramate-6-phosphate |
| Phylum: | Firmicutes |
| Propagated regulon: | |
| Target genome | Staphylococcus aureus subsp. aureus str. Newman |
| Orthologous TF(s) | NWMN_2217, NWMN_0137 |
| Regulated genes | 1 |
| Locus tag | Position | Score | Sequence | |
|---|---|---|---|---|
|
Position: -115
Score: 5.4 Sequence: ATATGTAAGATTATTACAATG
Locus tag: NWMN_0134
|
||||
| NWMN_0134 | -115 | 5.4 | ATATGTAAGATTATTACAATG | |
| Supported by regulated orthologs from reference regulons | ||||
| Ortholog gene name: SA0184 | ||||
| Ortholog function: Outer surface protein of unknown function, N-acetylmuramate-related | ||||
| Staphylococcus aureus subsp. aureus N315 | SA0184 | -133 | 5.4 | ATATGTAAGATTATTACAATG |
| Staphylococcus capitis SK14 | STACA0001_1175 | -65 | 5.3 | AATTGTAAACGTTTAATAATA |
| Staphylococcus epidermidis ATCC 12228 | SE1888 | -66 | 5.3 | AATTGTAAACTTGTTGCAATA |
| Staphylococcus carnosus subsp. carnosus TM300 | Sca_2140 | -114 | 5.6 | TATTGTAATAAAATTTCAATT |
| Staphylococcus haemolyticus JCSC1435 | SH0743 | -91 | 5.6 | AATTATAAAAATTATATAATA |
| Staphylococcus saprophyticus subsp. saprophyticus ATCC 15305 | SSP0596 | -105 | 5.3 | ATTTGTAATAAAATTTCATTT |
| -64 | 5.6 | AATTGTAATACTTTTTCATAT | ||