Propagation of MurR regulog to Staphylococcus aureus subsp. aureus JH9

Reference regulog properties
Source regulog:	MurR - Staphylococcaceae
Regulator type:	Transcription factor
Regulator family:	RpiR
Regulation mode:	repressor
Biological process:	N-acetylmuramate utilization
Effector:	N-acetylmuramate-6-phosphate
Phylum:	Firmicutes
Propagated regulon:
Target genome	Staphylococcus aureus subsp. aureus JH9
Orthologous TF(s)	SaurJH9_0178, SaurJH9_2339
Regulated genes	1

Built upon 7 sites [see more]

Predicted regulatory interactions in *Staphylococcus aureus subsp. aureus JH9*
	Locus tag	Position	Score	Sequence
Position: -133 Score: 5.4 Sequence: ATATGTAAGATTATTACAATG Locus tag: SaurJH9_0175
	SaurJH9_0175	-133	5.4	ATATGTAAGATTATTACAATG
Supported by regulated orthologs from reference regulons
Ortholog gene name: SA0184
Ortholog function: Outer surface protein of unknown function, N-acetylmuramate-related
Staphylococcus aureus subsp. aureus N315	SA0184	-133	5.4	ATATGTAAGATTATTACAATG
Staphylococcus capitis SK14	STACA0001_1175	-65	5.3	AATTGTAAACGTTTAATAATA
Staphylococcus epidermidis ATCC 12228	SE1888	-66	5.3	AATTGTAAACTTGTTGCAATA
Staphylococcus carnosus subsp. carnosus TM300	Sca_2140	-114	5.6	TATTGTAATAAAATTTCAATT
Staphylococcus haemolyticus JCSC1435	SH0743	-91	5.6	AATTATAAAAATTATATAATA
Staphylococcus saprophyticus subsp. saprophyticus ATCC 15305	SSP0596	-105	5.3	ATTTGTAATAAAATTTCATTT
		-64	5.6	AATTGTAATACTTTTTCATAT

Collection of Manually Curated Inferences of Regulons in Prokaryotic Genomes -- version 3.2 --