Propagation of CggR regulog to Staphylococcus aureus subsp. aureus Mu3
| Source regulog: | CggR - Staphylococcaceae |
| Regulator type: | Transcription factor |
| Regulator family: | SorC |
| Regulation mode: | repressor |
| Biological process: | Glycolysis |
| Effector: | Fructose-1,6-diphosphate |
| Phylum: | Firmicutes |
| Propagated regulon: | |
| Target genome | Staphylococcus aureus subsp. aureus Mu3 |
| Orthologous TF(s) | SAHV_0768 |
| Regulated genes | 1 |
| Locus tag | Position | Score | Sequence | |
|---|---|---|---|---|
|
Position: -85
Score: 6.9 Sequence: TTTTGTCCCACGCGGGACTTAA
Locus tag: SAHV_0768
|
||||
| SAHV_0768 | -85 | 6.9 | TTTTGTCCCACGCGGGACTTAA | |
| Supported by regulated orthologs from reference regulons | ||||
| Ortholog gene name: cggR | ||||
| Ortholog function: Transcriptional regulator of central glycolytic gene, SorC family | ||||
| Staphylococcus aureus subsp. aureus N315 | SA0726 | -85 | 6.9 | TTTTGTCCCACGCGGGACTTAA |
| Staphylococcus capitis SK14 | STACA0001_0256 | -91 | 6.7 | TTTTGTCCCAGGTGGGACTTAA |
| Staphylococcus epidermidis ATCC 12228 | SE0556 | -91 | 6.7 | TTTTGTCCCAGGTGGGACTTAA |
| Staphylococcus carnosus subsp. carnosus TM300 | Sca_0423 | -77 | 6.7 | TTTTGTCCCACCCGGGACTTAA |
| Staphylococcus haemolyticus JCSC1435 | SH2114 | -81 | 6.7 | TTTTGTCCCGCGCGGGACACAA |
| Staphylococcus saprophyticus subsp. saprophyticus ATCC 15305 | SSP1917 | -78 | 5.9 | TTTTGTCCTGCTAGGGACGTAA |
| Macrococcus caseolyticus JCSC5402 | MCCL_0520 | -47 | 5.9 | TTTTGACCCGAGTGGGACGAAT |