Propagation of CggR regulog to Staphylococcus capitis SK14
Source regulog: | CggR - Staphylococcaceae |
Regulator type: | Transcription factor |
Regulator family: | SorC |
Regulation mode: | repressor |
Biological process: | Glycolysis |
Effector: | Fructose-1,6-diphosphate |
Phylum: | Firmicutes |
Propagated regulon: | |
Target genome | Staphylococcus capitis SK14 |
Orthologous TF(s) | STACA0001_0256 |
Regulated genes | 1 |

Locus tag | Position | Score | Sequence | |
---|---|---|---|---|
Position: -91
Score: 6.7 Sequence: TTTTGTCCCAGGTGGGACTTAA
Locus tag: STACA0001_0256
|
||||
STACA0001_0256 | -91 | 6.7 | TTTTGTCCCAGGTGGGACTTAA | |
Supported by regulated orthologs from reference regulons | ||||
Ortholog gene name: cggR | ||||
Ortholog function: Transcriptional regulator of central glycolytic gene, SorC family | ||||
Staphylococcus aureus subsp. aureus N315 | SA0726 | -85 | 6.9 | TTTTGTCCCACGCGGGACTTAA |
Staphylococcus capitis SK14 | STACA0001_0256 | -91 | 6.7 | TTTTGTCCCAGGTGGGACTTAA |
Staphylococcus epidermidis ATCC 12228 | SE0556 | -91 | 6.7 | TTTTGTCCCAGGTGGGACTTAA |
Staphylococcus carnosus subsp. carnosus TM300 | Sca_0423 | -77 | 6.7 | TTTTGTCCCACCCGGGACTTAA |
Staphylococcus haemolyticus JCSC1435 | SH2114 | -81 | 6.7 | TTTTGTCCCGCGCGGGACACAA |
Staphylococcus saprophyticus subsp. saprophyticus ATCC 15305 | SSP1917 | -78 | 5.9 | TTTTGTCCTGCTAGGGACGTAA |
Macrococcus caseolyticus JCSC5402 | MCCL_0520 | -47 | 5.9 | TTTTGACCCGAGTGGGACGAAT |