Collection of Manually Curated Inferences of Regulons in Prokaryotic Genomes
-- version 3.2 --

Propagation of PUR regulog to Pseudoalteromonas haloplanktis TAC125

Reference regulog properties
Source regulog: PUR - Shewanellaceae
Regulator type: Transcription factor
Regulator family: [Other]
Regulation mode:
Biological process: Purine metabolism
Effector:
Phylum: Proteobacteria/gamma
Propagated regulon:
Target genome Pseudoalteromonas haloplanktis TAC125
Orthologous TF(s) No orthologous TFs found
Regulated genes 1
Built upon 60 sites [see more]
Predicted regulatory interactions in Pseudoalteromonas haloplanktis TAC125
Locus tag Position Score Sequence
Position: -69
Score: 4.7
Sequence: TATTATTCCCCCTCATTAAA
Locus tag: PSHAa2475
PSHAa2475 -69 4.7 TATTATTCCCCCTCATTAAA
Supported by regulated orthologs from reference regulons
Ortholog gene name: gcvT
Ortholog function: Aminomethyltransferase (glycine cleavage system T protein) (EC 2.1.2.10)
Shewanella oneidensis MR-1 SO_0779 -228 5.6 TATAATTTCGCCGCATTTTA
Shewanella putrefaciens CN-32 Sputcn32_3211 -84 5.6 TATAATTTCGCCGCATTTTA
Shewanella sp W3-18-1 Sputw3181_0730 -84 5.6 TATAATTTCGCCGCATTTTA
Shewanella sp ANA-3 Shewana3_3501 -228 5.6 TATAATTTCGCCGCATTTTA
Shewanella sp MR-4 Shewmr4_3331 -230 5.6 TATAATTTCGCCGCATTTTA
Shewanella sp MR-7 Shewmr7_0622 -229 5.6 TATAATTTCGCCGCATTTTA
Shewanella baltica OS155 Sbal_0617 -280 5.6 TATAATTTCGCCGCATTTTA
Shewanella frigidimarina NCIMB 400 Sfri_3151 -62 4.2 ATAATTTTGGCCGCATTTTA
Shewanella amazonensis SB2B Sama_2721 -73 5.6 TATAATTTCGCCGCATTTTA
Shewanella loihica PV-4 Shew_3064 -302 5.3 TATAATTTCGCCGCATTTTG
Shewanella pealeana ATCC 700345 Spea_3303 -164 5.6 TATAATTTCGCCGCATTTTA
Shewanella halifaxensis HAW-EB4 Shal_3375 -144 5.6 TATAATTTCGCCGCATTTTA
Shewanella piezotolerans WP3 swp_0913 -94 5.6 TATAATTTCGCCGCATTTTA
Shewanella sediminis HAW-EB3 Ssed_3675 -144 5.3 TATAATTTCGCCGCATTTTG
Shewanella woodyi ATCC 51908 Swoo_3969 -160 5.6 TATAATTTCGCCGCATTTTA