Propagation of ZntR regulog to Shewanella pealeana ATCC 700345
Source regulog: | ZntR - Shewanellaceae |
Regulator type: | Transcription factor |
Regulator family: | MerR |
Regulation mode: | activator |
Biological process: | Zinc resistance; Cadmium resistance |
Effector: | Zinc ion, (Zn2+); Cadmium, ion (Cd2+) |
Phylum: | Proteobacteria/Gamma |
Propagated regulon: | |
Target genome | Shewanella pealeana ATCC 700345 |
Orthologous TF(s) | Spea_0433 |
Regulated genes | 1 |

Locus tag | Position | Score | Sequence | |
---|---|---|---|---|
Position: -125
Score: 6.8 Sequence: ACCTTGGATACAACTCCAAGGT
Locus tag: Spea_0433
|
||||
Spea_0433 | -125 | 6.8 | ACCTTGGATACAACTCCAAGGT | |
Supported by regulated orthologs from reference regulons | ||||
Ortholog gene name: zntR | ||||
Ortholog function: Zinc resistance transcriptional regulator, MerR family | ||||
Shewanella oneidensis MR-1 | SO_0443 | -94 | 7 | ACCTTGGAGTAGGCTCCAAGGT |
Shewanella putrefaciens CN-32 | Sputcn32_3400 | -84 | 7 | ACCTTGGAGTAGGCTCCAAGGT |
Shewanella sp W3-18-1 | Sputw3181_0543 | -84 | 7 | ACCTTGGAGTAGGCTCCAAGGT |
Shewanella sp ANA-3 | Shewana3_0442 | -94 | 6.8 | ACCTTGGAGTAGGCTCTAAGGT |
Shewanella sp MR-4 | Shewmr4_0446 | -95 | 6.8 | ACCTTGGAGTAGGCTCTAAGGT |
Shewanella sp MR-7 | Shewmr7_3583 | -95 | 6.8 | ACCTTGGAGTAGGCTCTAAGGT |
Shewanella baltica OS155 | Sbal_0421 | -96 | 7 | ACCTTGGAGTAGGCTCCAAGGT |
Shewanella denitrificans OS217 | Sden_3408 | -72 | 7 | ACCTTAGATTAAACTCCAAGGT |
Shewanella frigidimarina NCIMB 400 | Sfri_0494 | -64 | 7.2 | ACCTTGGATTAAACTCCAAGGT |
Shewanella amazonensis SB2B | Sama_0396 | -59 | 7.2 | ACCTTGGATTAAACTCCAAGGT |
Shewanella loihica PV-4 | Shew_3411 | -66 | 6.9 | ACCTTAGATTTAACTCTAAGGT |
Shewanella pealeana ATCC 700345 | Spea_0433 | -125 | 6.8 | ACCTTGGATACAACTCCAAGGT |
Shewanella halifaxensis HAW-EB4 | Shal_0489 | -115 | 6.8 | ACCTTGGATACAACTCCAAGGT |
Shewanella piezotolerans WP3 | swp_4723 | -96 | 6.8 | ACCTTGGATACAACTCCAAGGT |
Shewanella sediminis HAW-EB3 | Ssed_0445 | -73 | 7.1 | ACCTTAGATTTAACTCCAAGGT |
Shewanella woodyi ATCC 51908 | Swoo_0297 | -73 | 7.1 | ACCTTGGATTTAACTCTAAGGT |