Collection of Manually Curated Inferences of Regulons in Prokaryotic Genomes
-- version 3.2 --

Propagation of PUR regulog to Shewanella sp W3-18-1

Reference regulog properties
Source regulog: PUR - Shewanellaceae
Regulator type: Transcription factor
Regulator family: [Other]
Regulation mode:
Biological process: Purine metabolism
Effector:
Phylum: Proteobacteria/gamma
Propagated regulon:
Target genome Shewanella sp W3-18-1
Orthologous TF(s) No orthologous TFs found
Regulated genes 4
Built upon 60 sites [see more]
Predicted regulatory interactions in Shewanella sp W3-18-1
Locus tag Position Score Sequence
Position: -84
Score: 5.6
Sequence: TATAATTTCGCCGCATTTTA
Locus tag: Sputw3181_0730
Sputw3181_0730 -84 5.6 TATAATTTCGCCGCATTTTA
Supported by regulated orthologs from reference regulons
Ortholog gene name: gcvT
Ortholog function: Aminomethyltransferase (glycine cleavage system T protein) (EC 2.1.2.10)
Shewanella oneidensis MR-1 SO_0779 -228 5.6 TATAATTTCGCCGCATTTTA
Shewanella putrefaciens CN-32 Sputcn32_3211 -84 5.6 TATAATTTCGCCGCATTTTA
Shewanella sp W3-18-1 Sputw3181_0730 -84 5.6 TATAATTTCGCCGCATTTTA
Shewanella sp ANA-3 Shewana3_3501 -228 5.6 TATAATTTCGCCGCATTTTA
Shewanella sp MR-4 Shewmr4_3331 -230 5.6 TATAATTTCGCCGCATTTTA
Shewanella sp MR-7 Shewmr7_0622 -229 5.6 TATAATTTCGCCGCATTTTA
Shewanella baltica OS155 Sbal_0617 -280 5.6 TATAATTTCGCCGCATTTTA
Shewanella frigidimarina NCIMB 400 Sfri_3151 -62 4.2 ATAATTTTGGCCGCATTTTA
Shewanella amazonensis SB2B Sama_2721 -73 5.6 TATAATTTCGCCGCATTTTA
Shewanella loihica PV-4 Shew_3064 -302 5.3 TATAATTTCGCCGCATTTTG
Shewanella pealeana ATCC 700345 Spea_3303 -164 5.6 TATAATTTCGCCGCATTTTA
Shewanella halifaxensis HAW-EB4 Shal_3375 -144 5.6 TATAATTTCGCCGCATTTTA
Shewanella piezotolerans WP3 swp_0913 -94 5.6 TATAATTTCGCCGCATTTTA
Shewanella sediminis HAW-EB3 Ssed_3675 -144 5.3 TATAATTTCGCCGCATTTTG
Shewanella woodyi ATCC 51908 Swoo_3969 -160 5.6 TATAATTTCGCCGCATTTTA
Position: -58
Score: 4.5
Sequence: TATAATCCCGCCGCAATATT
Locus tag: Sputw3181_1361
Sputw3181_1361 -58 4.5 TATAATCCCGCCGCAATATT
Supported by regulated orthologs from reference regulons
Ortholog gene name: guaB
Ortholog function: Inosine-5'-monophosphate dehydrogenase (EC 1.1.1.205)
Shewanella oneidensis MR-1 SO_3293 -59 4.5 TATAATCCCGCCGCAATATT
Shewanella putrefaciens CN-32 Sputcn32_2646 -58 4.5 TATAATCCCGCCGCAATATT
Shewanella sp W3-18-1 Sputw3181_1361 -58 4.5 TATAATCCCGCCGCAATATT
Shewanella sp ANA-3 Shewana3_1235 -59 4.5 TATAATCCCGCCGCAATATT
Shewanella sp MR-4 Shewmr4_1234 -59 4.5 TATAATCCCGCCGCAATATT
Shewanella sp MR-7 Shewmr7_1305 -59 4.5 TATAATCCCGCCGCAATATT
Shewanella baltica OS155 Sbal_2984 -58 4.5 TATAATCCCGCCGCAATATT
Shewanella denitrificans OS217 Sden_1269 -57 4.3 TATAATCTCGCCGCAATATT
Shewanella frigidimarina NCIMB 400 Sfri_1137 -55 4.3 TATAATCTCGCCGCAATATT
Shewanella amazonensis SB2B Sama_2359 -57 5.1 TATAATGCCGCCGCAATATT
Shewanella loihica PV-4 Shew_1297 -56 4.5 TATAATCCCGCCGCAATATT
Shewanella pealeana ATCC 700345 Spea_1313 -56 4.3 TATAATCTCGCCGCAATATT
Shewanella halifaxensis HAW-EB4 Shal_1376 -56 4.3 TATAATCTCGCCGCAATATT
Shewanella piezotolerans WP3 swp_1463 -56 4.3 TATAATCTCGCCGCAATATT
Shewanella sediminis HAW-EB3 Ssed_3124 -58 4.5 TATAATCCCGCCGCAATATT
Shewanella woodyi ATCC 51908 Swoo_1559 -57 4.5 TATAATCCCGCCGCAATATT
Position: -52
Score: 5.6
Sequence: TAGAATACCGCCGCATAAAA
Locus tag: Sputw3181_2426
Sputw3181_2426 -52 5.6 TAGAATACCGCCGCATAAAA
Supported by regulated orthologs from reference regulons
Ortholog gene name: purM
Ortholog function: Phosphoribosylformylglycinamidine cyclo-ligase (EC 6.3.3.1)
Shewanella oneidensis MR-1 SO_2760 -31 5.6 TAGAATACGGCCGCATAAAA
Shewanella putrefaciens CN-32 Sputcn32_1596 -52 5.6 TAGAATACCGCCGCATAAAA
Shewanella sp W3-18-1 Sputw3181_2426 -52 5.6 TAGAATACCGCCGCATAAAA
Shewanella sp ANA-3 Shewana3_2545 -52 5.6 TAGAATACCGCCGCATAAAA
Shewanella sp MR-4 Shewmr4_2380 -52 5.6 TAGAATACCGCCGCATAAAA
Shewanella sp MR-7 Shewmr7_2452 -52 5.6 TAGAATACCGCCGCATAAAA
Shewanella baltica OS155 Sbal_1735 -52 5.6 TAGAATACCGCCGCATAAAA
Shewanella denitrificans OS217 Sden_2094 -51 5.8 TAGAATGCCGCCGCATAAAA
Shewanella frigidimarina NCIMB 400 Sfri_1452 -53 5.2 TAGAATATTGCCGCATAAAA
Shewanella amazonensis SB2B Sama_2097 -53 5 TAGAATACGGCCCCAATAAA
Shewanella loihica PV-4 Shew_1513 -52 5.4 TAGAATAGCGCCGCATAAAA
Shewanella pealeana ATCC 700345 Spea_2577 -58 5 TAGAATGGCGCCGCGTAAAA
Shewanella halifaxensis HAW-EB4 Shal_1680 -59 5.4 TAGAATGACGCCGCATAAAA
Shewanella piezotolerans WP3 swp_1818 -57 5.4 TAGAATAGCGCCGCATAAAA
Shewanella sediminis HAW-EB3 Ssed_1845 -62 5.4 TAGAATAGCGCCGCATAAAA
Shewanella woodyi ATCC 51908 Swoo_2744 -53 5.6 TAGAATGGCGCCGCATAAAA
Position: -113
Score: 4.8
Sequence: TATTATTCTGCGCCATGATG
Locus tag: Sputw3181_3124
Sputw3181_3124 -113 4.8 TATTATTCTGCGCCATGATG
Supported by regulated orthologs from reference regulons
Ortholog gene name: purE
Ortholog function: Phosphoribosylaminoimidazole carboxylase catalytic subunit (EC 4.1.1.21)
Shewanella oneidensis MR-1 SO_3554 -113 4.8 TATTATTCTGCGCCATGATG
Shewanella putrefaciens CN-32 Sputcn32_1041 -113 4.3 TATTATTCTGCGCCATGGTG
Shewanella sp W3-18-1 Sputw3181_3124 -113 4.8 TATTATTCTGCGCCATGATG
Shewanella sp ANA-3 Shewana3_3155 -113 4.8 TATTATTCTGCGCCATGATG
Shewanella sp MR-4 Shewmr4_2975 -113 4.8 TATTATTCTGCGCCATGATG
Shewanella sp MR-7 Shewmr7_3057 -113 4.8 TATTATTCTGCGCCATGATG
Shewanella baltica OS155 Sbal_1036 -113 4.7 TATTATTCAGCGCCATGATG