Collection of Manually Curated Inferences of Regulons in Prokaryotic Genomes
-- version 3.2 --

Propagation of PUR regulog to Marinobacter sp. ELB17

Reference regulog properties
Source regulog: PUR - Shewanellaceae
Regulator type: Transcription factor
Regulator family: [Other]
Regulation mode:
Biological process: Purine metabolism
Effector:
Phylum: Proteobacteria/gamma
Propagated regulon:
Target genome Marinobacter sp. ELB17
Orthologous TF(s) No orthologous TFs found
Regulated genes 1
Built upon 60 sites [see more]
Predicted regulatory interactions in Marinobacter sp. ELB17
Locus tag Position Score Sequence
Position: -52
Score: 4.6
Sequence: TTTTATGCGGCCCCATTGTT
Locus tag: MELB17_14868
MELB17_14868 -52 4.6 TTTTATGCGGCCCCATTGTT
Supported by regulated orthologs from reference regulons
Ortholog gene name: guaA
Ortholog function: GMP synthase [glutamine-hydrolyzing] (EC 6.3.5.2)
Shewanella oneidensis MR-1 SO_3292 -59 4.5 TATAATCCCGCCGCAATATT
Shewanella putrefaciens CN-32 Sputcn32_2645 -58 4.5 TATAATCCCGCCGCAATATT
Shewanella sp W3-18-1 Sputw3181_1362 -58 4.5 TATAATCCCGCCGCAATATT
Shewanella sp ANA-3 Shewana3_1236 -59 4.5 TATAATCCCGCCGCAATATT
Shewanella sp MR-4 Shewmr4_1235 -59 4.5 TATAATCCCGCCGCAATATT
Shewanella sp MR-7 Shewmr7_1306 -59 4.5 TATAATCCCGCCGCAATATT
Shewanella baltica OS155 Sbal_2983 -58 4.5 TATAATCCCGCCGCAATATT
Shewanella denitrificans OS217 Sden_1270 -57 4.3 TATAATCTCGCCGCAATATT
Shewanella frigidimarina NCIMB 400 Sfri_1138 -55 4.3 TATAATCTCGCCGCAATATT
Shewanella amazonensis SB2B Sama_2358 -57 5.1 TATAATGCCGCCGCAATATT
Shewanella loihica PV-4 Shew_1298 -56 4.5 TATAATCCCGCCGCAATATT
Shewanella pealeana ATCC 700345 Spea_1314 -56 4.3 TATAATCTCGCCGCAATATT
Shewanella halifaxensis HAW-EB4 Shal_1377 -56 4.3 TATAATCTCGCCGCAATATT
Shewanella piezotolerans WP3 swp_1464 -56 4.3 TATAATCTCGCCGCAATATT
Shewanella sediminis HAW-EB3 Ssed_3123 -58 4.5 TATAATCCCGCCGCAATATT
Shewanella woodyi ATCC 51908 Swoo_1560 -57 4.5 TATAATCCCGCCGCAATATT
© 2009-2020 RegPrecise