Collection of Manually Curated Inferences of Regulons in Prokaryotic Genomes
-- version 3.2 --

Propagation of PUR regulog to Saccharophagus degradans 2-40

Reference regulog properties
Source regulog: PUR - Shewanellaceae
Regulator type: Transcription factor
Regulator family: [Other]
Regulation mode:
Biological process: Purine metabolism
Effector:
Phylum: Proteobacteria/gamma
Propagated regulon:
Target genome Saccharophagus degradans 2-40
Orthologous TF(s) No orthologous TFs found
Regulated genes 1
Built upon 60 sites [see more]
Predicted regulatory interactions in Saccharophagus degradans 2-40
Locus tag Position Score Sequence
Position: -54
Score: 5
Sequence: TAAAATGCCGCCCCAATCAA
Locus tag: Sde_0894
Sde_0894 -54 5 TAAAATGCCGCCCCAATCAA
Supported by regulated orthologs from reference regulons
Ortholog gene name: purM
Ortholog function: Phosphoribosylformylglycinamidine cyclo-ligase (EC 6.3.3.1)
Shewanella oneidensis MR-1 SO_2760 -31 5.6 TAGAATACGGCCGCATAAAA
Shewanella putrefaciens CN-32 Sputcn32_1596 -52 5.6 TAGAATACCGCCGCATAAAA
Shewanella sp W3-18-1 Sputw3181_2426 -52 5.6 TAGAATACCGCCGCATAAAA
Shewanella sp ANA-3 Shewana3_2545 -52 5.6 TAGAATACCGCCGCATAAAA
Shewanella sp MR-4 Shewmr4_2380 -52 5.6 TAGAATACCGCCGCATAAAA
Shewanella sp MR-7 Shewmr7_2452 -52 5.6 TAGAATACCGCCGCATAAAA
Shewanella baltica OS155 Sbal_1735 -52 5.6 TAGAATACCGCCGCATAAAA
Shewanella denitrificans OS217 Sden_2094 -51 5.8 TAGAATGCCGCCGCATAAAA
Shewanella frigidimarina NCIMB 400 Sfri_1452 -53 5.2 TAGAATATTGCCGCATAAAA
Shewanella amazonensis SB2B Sama_2097 -53 5 TAGAATACGGCCCCAATAAA
Shewanella loihica PV-4 Shew_1513 -52 5.4 TAGAATAGCGCCGCATAAAA
Shewanella pealeana ATCC 700345 Spea_2577 -58 5 TAGAATGGCGCCGCGTAAAA
Shewanella halifaxensis HAW-EB4 Shal_1680 -59 5.4 TAGAATGACGCCGCATAAAA
Shewanella piezotolerans WP3 swp_1818 -57 5.4 TAGAATAGCGCCGCATAAAA
Shewanella sediminis HAW-EB3 Ssed_1845 -62 5.4 TAGAATAGCGCCGCATAAAA
Shewanella woodyi ATCC 51908 Swoo_2744 -53 5.6 TAGAATGGCGCCGCATAAAA
© 2009-2020 RegPrecise