Orthologous regulated operons containing DMR_27630 gene

Properties
Regulog:	TunR - Desulfovibrionales
Regulator type:	Transcription factor
Regulator family:	TunR
Regulation mode:	activator
Biological process:	Tungsten homeostasis; Molybdenum homeostasis
Effector:	Molybdate; Tungsten
Phylum:	Proteobacteria/delta

Built upon 37 sites [see more]

Orthologous operons
Operon	Position	Score	Sequence	Locus Tag of the First Gene
Desulfovibrio magneticus RS-1
Position: -328 Score: 5.16303 Sequence: CTGTCATGTGAATAGAATTATTCGTGACAG Locus tag: DMR_27630 Name: null Funciton: putative TonB-dependent receptor Locus tag: DMR_27640 Name: null Funciton: hypothetical membrane protein Locus tag: DMR_27650 Name: null Funciton: putative ABC transporter ATP-binding protein Locus tag: DMR_27660 Name: null Funciton: hypothetical membrane protein
DMR_27630-DMR_27640-DMR_27650-DMR_27660	-328	5.2	CTGTCATGTGAATAGAATTATTCGTGACAG	DMR_27630

Collection of Manually Curated Inferences of Regulons in Prokaryotic Genomes -- version 3.2 --