Collection of Manually Curated Inferences of Regulons in Prokaryotic Genomes
-- version 3.2 --

Orthologous regulated operons containing DVU3081 gene

Properties
Regulog: LysX - Desulfovibrionales
Regulator type: Transcription factor
Regulator family: TrmB
Regulation mode:
Biological process: Lysine biosynthesis
Effector:
Phylum: Proteobacteria/delta
Built upon 11 sites [see more]
Orthologous operons
Operon Position Score Sequence Locus Tag of the First Gene
Desulfovibrio desulfuricans G20
Position: -83
Score: 5.87532
Sequence: GTATTTCTATTTAGTACCAC
Locus tag: Dde_0301
Name: null
Funciton: Permease of the drug/metabolite transporter (DMT) superfamily
Dde_0301 -83 5.9 GTATTTCTATTTAGTACCAC Dde_0301
© 2009-2020 RegPrecise