Collection of Manually Curated Inferences of Regulons in Prokaryotic Genomes
-- version 3.2 --

Orthologous regulated operons containing DMR_35210 gene

Properties
Regulog: DVU2423 - Desulfovibrionales
Regulator type: Transcription factor
Regulator family: HxlR
Regulation mode:
Biological process: Nitrogen metabolism
Effector:
Phylum: Proteobacteria/delta
Built upon 9 sites [see more]
Orthologous operons
Operon Position Score Sequence Locus Tag of the First Gene
Desulfovibrio magneticus RS-1
Position: -106
Score: 5.02958
Sequence: TGGTATCCAAAAGGATACTA
Locus tag: DMR_35230
Name: DVU2422
Funciton: Nitroreductase family protein
Locus tag: DMR_35220
Name: flr
Funciton: Flavoredoxin
Locus tag: DMR_35210
Name: null
Funciton: putative flavoredoxin
Locus tag: DMR_35200
Name: null
Funciton: NADPH-dependent FMN reductase
DVU2422-flr-DMR_35210-DMR_35200 -106 5 TGGTATCCAAAAGGATACTA DMR_35230