Collection of Manually Curated Inferences of Regulons in Prokaryotic Genomes
-- version 3.2 --

Orthologous regulated operons containing mntC gene

Properties
Regulog: MntR - Listeriaceae
Regulator type: Transcription factor
Regulator family: DtxR
Regulation mode: repressor
Biological process: Manganese homeostasis
Effector: Manganese ion, (Mn2+)
Phylum: Firmicutes
Built upon 8 sites [see more]
Orthologous operons
Operon Position Score Sequence Locus Tag of the First Gene
Listeria innocua Clip11262
Position: -68
Score: 6.32512
Sequence: AAAGTTGCATTAAGGAAACATT
Locus tag: lin1963
Name: mntB
Funciton: Manganese ABC transporter, inner membrane permease protein
Locus tag: lin1962
Name: mntC
Funciton: Manganese ABC transporter, inner membrane permease protein
Locus tag: lin1961
Name: mntA
Funciton: Manganese ABC transporter, inner membrane permease protein
mntB-mntC-mntA -68 6.3 AAAGTTGCATTAAGGAAACATT lin1963
Listeria monocytogenes EGD-e
Position: -68
Score: 6.41729
Sequence: AAAGTTGCTCTAAGGAAACATT
Locus tag: lmo1849
Name: mntB
Funciton: Manganese ABC transporter, inner membrane permease protein
Locus tag: lmo1848
Name: mntC
Funciton: Manganese ABC transporter, inner membrane permease protein
Locus tag: lmo1847
Name: mntA
Funciton: Manganese ABC transporter, inner membrane permease protein
mntB-mntC-mntA -68 6.4 AAAGTTGCTCTAAGGAAACATT lmo1849
Listeria seeligeri serovar 1/2b str. SLCC3954
Position: -69
Score: 6.41729
Sequence: AAAGTTGCTCTAAGGAAACATT
Locus tag: lse_1829
Name: mntB
Funciton: Manganese ABC transporter, inner membrane permease protein
Locus tag: lse_1828
Name: mntC
Funciton: Manganese ABC transporter, inner membrane permease protein
Locus tag: lse_1827
Name: mntA
Funciton: Manganese ABC transporter, inner membrane permease protein
mntB-mntC-mntA -69 6.4 AAAGTTGCTCTAAGGAAACATT lse_1829
Listeria welshimeri serovar 6b str. SLCC5334
Position: -68
Score: 6.41729
Sequence: AAAGTTGCTCTAAGGAAACATT
Locus tag: lwe1868
Name: mntB
Funciton: Manganese ABC transporter, inner membrane permease protein
Locus tag: lwe1867
Name: mntC
Funciton: Manganese ABC transporter, inner membrane permease protein
Locus tag: lwe1866
Name: mntA
Funciton: Manganese ABC transporter, inner membrane permease protein
mntB-mntC-mntA -68 6.4 AAAGTTGCTCTAAGGAAACATT lwe1868