Collection of Manually Curated Inferences of Regulons in Prokaryotic Genomes
-- version 3.2 --

Orthologous regulated operons containing moaA gene

Properties
Regulog: ModE2 - Flavobacteria
Regulator type: Transcription factor
Regulator family: ModE
Regulation mode:
Biological process: Molybdopterin biosynthesis
Effector: Molybdate
Phylum: Bacteroidetes
Built upon 2 sites [see more]
Orthologous operons
Operon Position Score Sequence Locus Tag of the First Gene
Gramella forsetii KT0803
Position: -33
Score: 6.76833
Sequence: CGATATATATACAAATACATAACG
Locus tag: orf441
Name: iscS
Funciton: Cysteine desulfurase (EC 2.8.1.7)
Locus tag: orf442
Name: orf442
Funciton: Putative dehydrogenase
Locus tag: orf443
Name: null
Funciton: Molybdopterin-guanine dinucleotide biosynthesis protein MobA
Locus tag: orf444
Name: moaD
Funciton: Molybdenum cofactor biosynthesis protein MoaD
Locus tag: orf445
Name: moeB
Funciton: Molybdopterin biosynthesis protein MoeB
Locus tag: orf446
Name: moaE
Funciton: Molybdenum cofactor biosynthesis protein MoaE
Locus tag: orf447
Name: moaCB
Funciton: Molybdenum cofactor biosynthesis fusion protein MoaC/MoaB
Locus tag: orf448
Name: moaA
Funciton: Molybdenum cofactor biosynthesis protein MoaA
Locus tag: orf449
Name: moeA
Funciton: Molybdopterin biosynthesis protein MoeA
iscS-orf442-orf443-moaD-moeB-moaE-moaCB-moaA-moeA -33 6.8 CGATATATATACAAATACATAACG orf441
Leeuwenhoekiella blandensis MED217
Position: -33
Score: 6.76833
Sequence: CGTTATATTCGCTAAAACATAACG
Locus tag: MED217_08765
Name: moeA
Funciton: Molybdopterin biosynthesis protein MoeA
Locus tag: MED217_08760
Name: modE2
Funciton: Molybdate-responsive transcriptional regulator ModE2, ModE family
Locus tag: MED217_08755
Name: mobA
Funciton: Molybdopterin-guanine dinucleotide biosynthesis protein MobA
Locus tag: MED217_08750
Name: moaD
Funciton: Molybdenum cofactor biosynthesis protein MoaD
Locus tag: MED217_08745
Name: moeB
Funciton: Molybdopterin biosynthesis protein MoeB
Locus tag: MED217_08740
Name: moaE
Funciton: Molybdenum cofactor biosynthesis protein MoaE
Locus tag: MED217_08735
Name: moaCB
Funciton: Molybdenum cofactor biosynthesis fusion protein MoaC/MoaB
Locus tag: MED217_08730
Name: moaA
Funciton: Molybdenum cofactor biosynthesis protein MoaA
moeA-modE2-mobA-moaD-moeB-moaE-moaCB-moaA -33 6.8 CGTTATATTCGCTAAAACATAACG MED217_08765