Orthologous regulated operons containing rbsD gene

Properties
Regulog:	RbsR - Streptomycetaceae
Regulator type:	Transcription factor
Regulator family:	LacI
Regulation mode:	repressor
Biological process:	Ribose utilization
Effector:	Ribose
Phylum:	Actinobacteria

Built upon 3 sites [see more]

Orthologous operons
Operon	Position	Score	Sequence	Locus Tag of the First Gene
Streptomyces avermitilis MA-4680
Position: -66 Score: 6.45418 Sequence: CGATGTAATCGATTCCACGA Locus tag: SAV_5320 Name: rbsR Funciton: Transcriptional repressor of ribose utilization, LacI famil Locus tag: SAV_5319 Name: rbsA Funciton: Ribose ABC transporter, ATP-binding protein (TC 3.A.1.2.1) Locus tag: SAV_5318 Name: rbsBC Funciton: Ribose ABC transport system, periplasmic ribose-binding protein RbsB (TC 3.A.1.2.1) / Ribose ABC transport system, permease protein RbsC (TC 3.A.1.2.1) Locus tag: SAV_5317 Name: rbsK Funciton: Ribokinase (EC 2.7.1.15) Locus tag: SAV_5316 Name: rbsD Funciton: D-ribose pyranase (D-ribose mutarotase) (EC 5.5.1.n1)
rbsR-rbsA-rbsBC-rbsK-rbsD	-66	6.5	CGATGTAATCGATTCCACGA	SAV_5320
Streptomyces coelicolor A3(2)
Position: -35 Score: 6.82754 Sequence: CCGTGTAATCGATTCCACGA Locus tag: SCO2745 Name: rbsR Funciton: Transcriptional repressor of ribose utilization, LacI famil Locus tag: SCO2746 Name: rbsA Funciton: Ribose ABC transporter, ATP-binding protein (TC 3.A.1.2.1) Locus tag: SCO2747 Name: rbsBC Funciton: Ribose ABC transport system, periplasmic ribose-binding protein RbsB (TC 3.A.1.2.1) / Ribose ABC transport system, permease protein RbsC (TC 3.A.1.2.1) Locus tag: SCO2748 Name: rbsK Funciton: Ribokinase (EC 2.7.1.15) Locus tag: SCO2749 Name: rbsD Funciton: D-ribose pyranase (D-ribose mutarotase) (EC 5.5.1.n1)
rbsR-rbsA-rbsBC-rbsK-rbsD	-35	6.8	CCGTGTAATCGATTCCACGA	SCO2745
Streptomyces griseus subsp. griseus NBRC 13350
Position: -96 Score: 6.82754 Sequence: CCGTGTAATCGATTCCATGG Locus tag: SGR_1097 Name: rbsR Funciton: Transcriptional repressor of ribose utilization, LacI famil Locus tag: SGR_1096 Name: rbsA Funciton: Ribose ABC transporter, ATP-binding protein (TC 3.A.1.2.1) Locus tag: SGR_1095 Name: rbsBC Funciton: Ribose ABC transport system, periplasmic ribose-binding protein RbsB (TC 3.A.1.2.1) / Ribose ABC transport system, permease protein RbsC (TC 3.A.1.2.1) Locus tag: SGR_1094 Name: rbsK Funciton: Ribokinase (EC 2.7.1.15) Locus tag: SGR_1093 Name: rbsD Funciton: D-ribose pyranase (D-ribose mutarotase) (EC 5.5.1.n1)
rbsR-rbsA-rbsBC-rbsK-rbsD	-96	6.8	CCGTGTAATCGATTCCATGG	SGR_1097