Orthologous regulated operons containing malG gene

Properties
Regulog:	MalR2 - Clostridia-1
Regulator type:	Transcription factor
Regulator family:	LacI
Regulation mode:	repressor
Biological process:	Maltose utilization; Maltodextrin utilization
Effector:	Maltose
Phylum:	Firmicutes

Built upon 10 sites [see more]

Orthologous operons
Operon	Position	Score	Sequence	Locus Tag of the First Gene
Clostridium beijerincki NCIMB 8052
Position: -139 Score: 5.95672 Sequence: TTTCGCAATCGTTTGCGAAA Locus tag: Cbei_0230 Name: malE Funciton: Maltose/maltodextrin ABC transporter, substrate-binding component Locus tag: Cbei_0231 Name: malF Funciton: Maltose/maltodextrin ABC transporter, permease protein 1 Locus tag: Cbei_0232 Name: malG Funciton: Maltose/maltodextrin ABC transporter, permease protein 2
malE-malF-malG	-139	6	TTTCGCAATCGTTTGCGAAA	Cbei_0230
Clostridium butyricum 5521
Position: -108 Score: 6.46562 Sequence: TTTTGCAAGCGATTGCATAT Locus tag: CBY_2940 Name: malE Funciton: Maltose/maltodextrin ABC transporter, substrate-binding component Locus tag: CBY_2941 Name: malF Funciton: Maltose/maltodextrin ABC transporter, permease protein 1 Locus tag: CBY_2942 Name: malG Funciton: Maltose/maltodextrin ABC transporter, permease protein 2
malE-malF-malG	-108	6.5	TTTTGCAAGCGATTGCATAT	CBY_2940

Collection of Manually Curated Inferences of Regulons in Prokaryotic Genomes -- version 3.2 --