Collection of Manually Curated Inferences of Regulons in Prokaryotic Genomes
-- version 3.2 --

Orthologous regulated operons containing malF gene

Properties
Regulog: MalR2 - Clostridia-1
Regulator type: Transcription factor
Regulator family: LacI
Regulation mode: repressor
Biological process: Maltose utilization; Maltodextrin utilization
Effector: Maltose
Phylum: Firmicutes
Built upon 10 sites [see more]
Orthologous operons
Operon Position Score Sequence Locus Tag of the First Gene
Clostridium beijerincki NCIMB 8052
Position: -139
Score: 5.95672
Sequence: TTTCGCAATCGTTTGCGAAA
Locus tag: Cbei_0230
Name: malE
Funciton: Maltose/maltodextrin ABC transporter, substrate-binding component
Locus tag: Cbei_0231
Name: malF
Funciton: Maltose/maltodextrin ABC transporter, permease protein 1
Locus tag: Cbei_0232
Name: malG
Funciton: Maltose/maltodextrin ABC transporter, permease protein 2
malE-malF-malG -139 6 TTTCGCAATCGTTTGCGAAA Cbei_0230
Clostridium butyricum 5521
Position: -108
Score: 6.46562
Sequence: TTTTGCAAGCGATTGCATAT
Locus tag: CBY_2940
Name: malE
Funciton: Maltose/maltodextrin ABC transporter, substrate-binding component
Locus tag: CBY_2941
Name: malF
Funciton: Maltose/maltodextrin ABC transporter, permease protein 1
Locus tag: CBY_2942
Name: malG
Funciton: Maltose/maltodextrin ABC transporter, permease protein 2
malE-malF-malG -108 6.5 TTTTGCAAGCGATTGCATAT CBY_2940