Collection of Manually Curated Inferences of Regulons in Prokaryotic Genomes
-- version 3.2 --

Orthologous regulated operons containing mtsCA gene

Properties
Regulog: MntR - Corynebacteriaceae
Regulator type: Transcription factor
Regulator family: DtxR
Regulation mode: repressor
Biological process: Manganese homeostasis
Effector: Manganese ion, (Mn2+)
Phylum: Actinobacteria
Built upon 16 sites [see more]
Orthologous operons
Operon Position Score Sequence Locus Tag of the First Gene
Corynebacterium urealyticum DSM 7109
Position: -56
Score: 6.63223
Sequence: AAGTTCAATACATTGAACTT
Locus tag: cur_0526
Name: mtsB
Funciton: Manganese ABC transporter, ATP-binding protein
Locus tag: cur_0525
Name: mtsCA
Funciton: Manganese ABC transporter, permease and substrate-binding protein
mtsB-mtsCA -56 6.6 AAGTTCAATACATTGAACTT cur_0526