Collection of Manually Curated Inferences of Regulons in Prokaryotic Genomes
-- version 3.2 --

Orthologous regulated operons containing mntA gene

Properties
Regulog: MntR - Corynebacteriaceae
Regulator type: Transcription factor
Regulator family: DtxR
Regulation mode: repressor
Biological process: Manganese homeostasis
Effector: Manganese ion, (Mn2+)
Phylum: Actinobacteria
Built upon 16 sites [see more]
Orthologous operons
Operon Position Score Sequence Locus Tag of the First Gene
Corynebacterium amycolatum SK46
Position: -153
Score: 6.11441
Sequence: AAGTTCAATGGGTTGAAAAT
Locus tag: CORAM0001_0534
Name: mntA
Funciton: Manganese ABC transporter, substrate-binding protein
Locus tag: CORAM0001_0535
Name: mntB
Funciton: Manganese ABC transporter, ATP-binding protein
Locus tag: CORAM0001_0536
Name: mntC
Funciton: Manganese ABC transporter, permease protein 1
Locus tag: CORAM0001_0537
Name: mntD
Funciton: Manganese ABC transporter, permease protein 2
Locus tag: CORAM0001_0538
Name: mntR
Funciton: Mn-dependent transcriptional regulator MntR, DtxR family
mntA-mntB-mntC-mntD-mntR -153 6.1 AAGTTCAATGGGTTGAAAAT CORAM0001_0534
Corynebacterium diphtheriae NCTC 13129
Position: -91
Score: 5.64255
Sequence: AAATTCAATACGCTGAACAG
Locus tag: DIP0615
Name: mntA
Funciton: Manganese ABC transporter, substrate-binding protein
Locus tag: DIP0616
Name: mntB
Funciton: Manganese ABC transporter, ATP-binding protein
Locus tag: DIP0617
Name: mntC
Funciton: Manganese ABC transporter, permease protein 1
Locus tag: DIP0618
Name: mntD
Funciton: Manganese ABC transporter, permease protein 2
Locus tag: DIP0619
Name: mntR
Funciton: Mn-dependent transcriptional regulator MntR, DtxR family
mntA-mntB-mntC-mntD-mntR -91 5.6 AAATTCAATACGCTGAACAG DIP0615