Orthologous regulated operons containing acdH2 gene

Properties
Regulog:	PsrA - Oceanospirillales/Alteromonadales
Regulator type:	Transcription factor
Regulator family:	TetR
Regulation mode:	repressor
Biological process:	Fatty acid degradation
Effector:	Oleate
Phylum:	Proteobacteria/gamma

Built upon 67 sites [see more]

Orthologous operons
Operon	Position	Score	Sequence	Locus Tag of the First Gene
Saccharophagus degradans 2-40
Position: -162 Score: 5.71368 Sequence: ATTTAAACGTTTGTTTTAAT Locus tag: Sde_3132 Name: acdH2 Funciton: Acyl-CoA dehydrogenase (EC 1.3.99.3)
acdH2	-162	5.7	ATTTAAACGTTTGTTTTAAT	Sde_3132

Collection of Manually Curated Inferences of Regulons in Prokaryotic Genomes -- version 3.2 --