Orthologous regulated operons containing Csal_2644 gene

Properties
Regulog:	PsrA - Oceanospirillales/Alteromonadales
Regulator type:	Transcription factor
Regulator family:	TetR
Regulation mode:	repressor
Biological process:	Fatty acid degradation
Effector:	Oleate
Phylum:	Proteobacteria/gamma

Built upon 67 sites [see more]

Orthologous operons
Operon	Position	Score	Sequence	Locus Tag of the First Gene
Chromohalobacter salexigens DSM 3043
Position: -36 Score: 4.99905 Sequence: ATTCACACATACGTTTGCAT Locus tag: Csal_2644 Name: null Funciton: acyl-CoA dehydrogenase-like protein
Csal_2644	-36	5	ATTCACACATACGTTTGCAT	Csal_2644

Collection of Manually Curated Inferences of Regulons in Prokaryotic Genomes -- version 3.2 --