Orthologous regulated operons containing MED297_00330 gene

Properties
Regulog:	PsrA - Oceanospirillales/Alteromonadales
Regulator type:	Transcription factor
Regulator family:	TetR
Regulation mode:	repressor
Biological process:	Fatty acid degradation
Effector:	Oleate
Phylum:	Proteobacteria/gamma

Built upon 67 sites [see more]

Orthologous operons
Operon	Position	Score	Sequence	Locus Tag of the First Gene
Reinekea sp. MED297
Position: -67 Score: 5.83947 Sequence: ATTCAAACGCGCGTTTAAAT Locus tag: MED297_00330 Name: null Funciton: enoyl-CoA hydratase/isomerase family protein
MED297_00330	-67	5.8	ATTCAAACGCGCGTTTAAAT	MED297_00330

Collection of Manually Curated Inferences of Regulons in Prokaryotic Genomes -- version 3.2 --