Collection of Manually Curated Inferences of Regulons in Prokaryotic Genomes
-- version 3.2 --

Orthologous regulated operons containing MED297_20722 gene

Properties
Regulog: PsrA - Oceanospirillales/Alteromonadales
Regulator type: Transcription factor
Regulator family: TetR
Regulation mode: repressor
Biological process: Fatty acid degradation
Effector: Oleate
Phylum: Proteobacteria/gamma
Built upon 67 sites [see more]
Orthologous operons
Operon Position Score Sequence Locus Tag of the First Gene
Reinekea sp. MED297
Position: -55
Score: 6.15688
Sequence: ATTCAAACGACCGTTTGAAT
Locus tag: MED297_20722
Name: null
Funciton: TesB-like acyl-CoA thioesterase 1
MED297_20722 -55 6.2 ATTCAAACGACCGTTTGAAT MED297_20722