Orthologous regulated operons containing Maqu_1467 gene

Properties
Regulog:	PsrA - Oceanospirillales/Alteromonadales
Regulator type:	Transcription factor
Regulator family:	TetR
Regulation mode:	repressor
Biological process:	Fatty acid degradation
Effector:	Oleate
Phylum:	Proteobacteria/gamma

Built upon 67 sites [see more]

Orthologous operons
Operon	Position	Score	Sequence	Locus Tag of the First Gene
Marinobacter aqueolei
Position: -31 Score: 5.49938 Sequence: ATTCATACATTCGTTTGAAC Locus tag: Maqu_1467 Name: null Funciton: putative saccharopine dehydrogenase
Maqu_1467	-31	5.5	ATTCATACATTCGTTTGAAC	Maqu_1467
Marinobacter sp. ELB17
Position: -202 Score: 5.43499 Sequence: AAACAAACGTTTGTTTTAAT Locus tag: MELB17_13682 Name: etfB Funciton: Electron transfer flavoprotein, beta subunit Locus tag: MELB17_13677 Name: etfA Funciton: Electron transfer flavoprotein, alpha subunit Locus tag: MELB17_13672 Name: null Funciton: putative saccharopine dehydrogenase
etfB-etfA-MELB17_13672	-202	5.4	AAACAAACGTTTGTTTTAAT	MELB17_13682

Collection of Manually Curated Inferences of Regulons in Prokaryotic Genomes -- version 3.2 --