Collection of Manually Curated Inferences of Regulons in Prokaryotic Genomes
-- version 3.2 --

Orthologous regulated operons containing Dde_0552 gene

Properties
Regulog: Rex - Desulfovibrionales
Regulator type: Transcription factor
Regulator family: Rex
Regulation mode: repressor
Biological process: Energy metabolism
Effector: NADH
Phylum: Proteobacteria/delta
Built upon 107 sites [see more]
Orthologous operons
Operon Position Score Sequence Locus Tag of the First Gene
Desulfovibrio desulfuricans G20
Position: -33
Score: 5.27041
Sequence: CTTGGGAAATTTTGCACAAC
Locus tag: Dde_0552
Name: null
Funciton: hypothetical protein
Dde_0552 -33 5.3 CTTGGGAAATTTTGCACAAC Dde_0552
© 2009-2020 RegPrecise