Collection of Manually Curated Inferences of Regulons in Prokaryotic Genomes
-- version 3.2 --

Orthologous regulated operons containing wtpB gene

Properties
Regulog: ModE2 - Desulfovibrionales
Regulator type: Transcription factor
Regulator family: ModE
Regulation mode: repressor
Biological process: Molybdopterin biosynthesis; Molybdenum homeostasis
Effector: Molybdenum
Phylum: Proteobacteria/delta
Built upon 48 sites [see more]
Orthologous operons
Operon Position Score Sequence Locus Tag of the First Gene
Desulfohalobium retbaense DSM 5692
Position: -32
Score: 4.40957
Sequence: TATATGTCTTTTTTAGCAAAGG
Locus tag: Dret_0525
Name: wtpA
Funciton: ABC-type tungstate/molybdate transport system, periplasmic component
Locus tag: Dret_0526
Name: wtpB
Funciton: ABC-type tungstate/molybdate transport system, permease protein
Locus tag: Dret_0527
Name: wtpC
Funciton: ABC-type tungstate/molybdate transport system, ATP-binding component
wtpA-wtpB-wtpC -32 4.4 TATATGTCTTTTTTAGCAAAGG Dret_0525
Desulfovibrio salexigens DSM 2638
Position: -106
Score: 5.02761
Sequence: ATTATGCTCTCCATGACATATG
Locus tag: Desal_2416
Name: wtpA
Funciton: ABC-type tungstate/molybdate transport system, periplasmic component
Locus tag: Desal_2417
Name: wtpB
Funciton: ABC-type tungstate/molybdate transport system, permease protein
Locus tag: Desal_2418
Name: wtpC
Funciton: ABC-type tungstate/molybdate transport system, ATP-binding component
wtpA-wtpB-wtpC -106 5 ATTATGCTCTCCATGACATATG Desal_2416