Orthologous regulated operons containing fdhD gene

Properties
Regulog:	ModE2 - Desulfovibrionales
Regulator type:	Transcription factor
Regulator family:	ModE
Regulation mode:	repressor
Biological process:	Molybdopterin biosynthesis; Molybdenum homeostasis
Effector:	Molybdenum
Phylum:	Proteobacteria/delta

Built upon 48 sites [see more]

Orthologous operons
Operon	Position	Score	Sequence	Locus Tag of the First Gene
Desulfovibrio desulfuricans G20
Position: -133 Score: 5.20211 Sequence: GTTGTGTTAATATTAACACATT Locus tag: Dde_3512 Name: fdnG Funciton: formate dehydrogenase alpha subunit Locus tag: Dde_3513 Name: null Funciton: formate dehydrogenase, alpha subunit Locus tag: Dde_3514 Name: null Funciton: Formate dehydrogenase O beta subunit (EC 1.2.1.2) Locus tag: Dde_3515 Name: null Funciton: formate dehydrogenase formation protein FdhE, putative Locus tag: Dde_3516 Name: fdhD Funciton: Formate dehydrogenase chain D (EC 1.2.1.2)
fdnG-Dde_3513-Dde_3514-Dde_3515-fdhD	-133	5.2	GTTGTGTTAATATTAACACATT	Dde_3512

Collection of Manually Curated Inferences of Regulons in Prokaryotic Genomes -- version 3.2 --