Collection of Manually Curated Inferences of Regulons in Prokaryotic Genomes
-- version 3.2 --

Orthologous regulated operons containing modA gene

Properties
Regulog: ModE2 - Rhodospirillales
Regulator type: Transcription factor
Regulator family: ModE
Regulation mode: repressor (activator)
Biological process: Molybdenum homeostasis
Effector: Molybdate
Phylum: Proteobacteria/alpha
Built upon 2 sites [see more]
Orthologous operons
Operon Position Score Sequence Locus Tag of the First Gene
Azospirillum sp. B510
Position: -21
Score: 5.42796
Sequence: GCTGTATCCGTTTGAATATATA
Locus tag: AZL_015260
Name: modA
Funciton: Molybdate ABC transporter, substrate-binding protein
Locus tag: AZL_015250
Name: modB
Funciton: Molybdate ABC transporter, permease protein
Locus tag: AZL_015240
Name: modC
Funciton: Molybdate ABC transporter, ATP-binding protein
modA-modB-modC -21 5.4 GCTGTATCCGTTTGAATATATA AZL_015260
Rhodospirillum centenum SW
Position: -41
Score: 5.4721
Sequence: GATGTATTCTCATGGATACATC
Locus tag: RC1_2219
Name: modA
Funciton: Molybdate ABC transporter, substrate-binding protein
Locus tag: RC1_2218
Name: modB
Funciton: Molybdate ABC transporter, permease protein
Locus tag: RC1_2216
Name: modC
Funciton: Molybdate ABC transporter, ATP-binding protein
modA-modB-modC -41 5.5 GATGTATTCTCATGGATACATC RC1_2219