Orthologous regulated operons containing modB gene

Properties
Regulog:	ModE - Oceanospirillales/Alteromonadales
Regulator type:	Transcription factor
Regulator family:	ModE
Regulation mode:	repressor (activator)
Biological process:	Molybdenum homeostasis
Effector:	Molybdate
Phylum:	Proteobacteria/gamma

Built upon 2 sites [see more]

Orthologous operons
Operon	Position	Score	Sequence	Locus Tag of the First Gene
Marinomonas sp. MWYL1
Position: -73 Score: 6.57942 Sequence: TTCGTTATATAGTTCAATATATAACGAA Locus tag: Mmwyl1_0979 Name: modA Funciton: Molybdate ABC transporter, substrate-binding protein Locus tag: Mmwyl1_0978 Name: modB Funciton: Molybdate ABC transporter, permease protein Locus tag: Mmwyl1_0977 Name: modC Funciton: Molybdate ABC transporter, ATP-binding protein
modA-modB-modC	-73	6.6	TTCGTTATATAGTTCAATATATAACGAA	Mmwyl1_0979

Collection of Manually Curated Inferences of Regulons in Prokaryotic Genomes -- version 3.2 --